STRIDE-DB

Repeat Length	AFR	AMR	EUR	EAS	SAS	Repeat
13.7	322	100	292	125	291	GCGGCGGCGGCGGCAGCGGCGGCTGCGGCGGCGGCGGCGGC
4.7	0	0	1	0	2	GCGGCGGCGGCGGC
6.7	2	0	0	2	0	GCGGCGGCGGCGGCAGCGGC
9.7	0	0	0	3	0	GCGGCGGCGGCGGCAGCGGCGGCTGCGGC
10.3	0	0	0	0	2	GCGGCGGCGGCGGCAGCGGCGGCTGCGGCGG
10.7	0	0	1	0	0	GCGGCGGCGGCGGCAGCGGCGGCTGCGGCGGC
12.0	0	0	1	0	0	GCGGCGGCGGCGGCAGCGGCGGCTGCGGCGGCGGCG
12.7	0	0	3	0	3	GCGGCGGCGGCGGCAGCGGCGGCTGCGGCGGCGGCGGC
13.3	0	0	0	0	1	GCGGCGGCGGCGGCAGCGGCGGCTGCGGCGGCGGCGGCGG
14.0	2	0	0	0	0	GCGGCGGCGGCGGCAGCGGCGGCTGCGGCGGCGGCGGCGGCG
15.7	0	0	0	0	1	GCGGCGGCGGCGGCAGCGGCGGCTGCGGCGGCGGCGGCGGCGGCGGC

Position	Disease/Trait	P-value	SNPs	Location with respect to STR	distance	Study
2:176921644	Pelvic organ prolapse,	5.0E-8	rs77648136	downstream	-36143	Advancing our understanding of genetic risk factors and potential personalized strategies for pelvic organ prolapse.
2:176935525	Bevacizumab-induced composite toxicity (either hypertension or proteinuria),	9.0E-6	rs1000032	downstream	-22262	Bevacizumab-induced hypertension and proteinuria: a genome-wide study of more than 1000 patients.
2:176951487	Urate levels,	2.0E-9	rs12474905	downstream	-6300	Urate, Blood Pressure, and Cardiovascular Disease: Evidence From Mendelian Randomization and Meta-Analysis of Clinical Trials.
2:176962102	Digit length ratio (left hand),	1.0E-7	rs847158	upstream	4315	Genome-wide association study identifies nine novel loci for 2D:4D finger ratio, a putative retrospective biomarker of testosterone exposure in utero.
2:176962102	Digit length ratio (right hand),	6.0E-9	rs847158	upstream	4315	Genome-wide association study identifies nine novel loci for 2D:4D finger ratio, a putative retrospective biomarker of testosterone exposure in utero.
2:176962102	Digit length ratio,	1.0E-10	rs847158	upstream	4315	Genome-wide association study identifies nine novel loci for 2D:4D finger ratio, a putative retrospective biomarker of testosterone exposure in utero.
2:176962102	Digit length ratio (left hand),	6.0E-7	rs847158	upstream	4315	Genome-wide association study identifies nine novel loci for 2D:4D finger ratio, a putative retrospective biomarker of testosterone exposure in utero.
2:176962501	Height,	2.0E-9	rs847157	upstream	4714	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
2:176969206	Appendicular lean mass,	8.0E-14	rs741610	upstream	11419	The genetic architecture of appendicular lean mass characterized by association analysis in the UK Biobank study.
2:176970247	Immature Myeloid-Derived Suppressor Cells %CD33dim HLA DR- CD66b-,	3.0E-8	rs72923436	upstream	12460	Complex genetic signatures in immune cells underlie autoimmunity and inform therapy.
2:176970456	Haemorrhoidal disease,	1.0E-17	rs847148	upstream	12669	Genome-wide analysis of 944 133 individuals provides insights into the etiology of haemorrhoidal disease.
2:176970659	Heel bone mineral density,	6.0E-17	rs847147	upstream	12872	An atlas of genetic influences on osteoporosis in humans and mice.
2:176970659	Heel bone mineral density,	1.0E-18	rs847147	upstream	12872	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
2:176970659	Heel bone mineral density,	2.0E-18	rs847147	upstream	12872	Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
2:176974104	Hemoglobin levels,	1.0E-19	rs863678	upstream	16317	Predicted loss and gain of function mutations in ACO1 are associated with erythropoiesis.
2:176974104	Creatinine levels,	1.0E-8	rs863678	upstream	16317	Sex-specific and pleiotropic effects underlying kidney function identified from GWAS meta-analysis.
2:176974104	Red blood cell count,	4.0E-44	rs863678	upstream	16317	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
2:176974104	Hemoglobin,	2.0E-25	rs863678	upstream	16317	The Polygenic and Monogenic Basis of Blood Traits and Diseases.
2:176974104	Red blood cell count,	1.0E-35	rs863678	upstream	16317	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
2:176974104	Hematocrit,	3.0E-9	rs863678	upstream	16317	The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease.
2:176974104	Hematocrit,	2.0E-39	rs863678	upstream	16317	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
2:176974104	Hemoglobin concentration,	2.0E-40	rs863678	upstream	16317	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
2:176974104	Hemoglobin concentration,	4.0E-33	rs863678	upstream	16317	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
2:176974104	Hematocrit,	1.0E-47	rs863678	upstream	16317	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
2:176974104	Hematocrit,	3.0E-31	rs863678	upstream	16317	The Polygenic and Monogenic Basis of Blood Traits and Diseases.
2:176974104	Red blood cell count,	7.0E-27	rs863678	upstream	16317	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
2:176974104	Kidney volume,	4.0E-8	rs863678	upstream	16317	Genetic architecture of 11 organ traits derived from abdominal MRI using deep learning.
2:176974104	Hemoglobin,	2.0E-9	rs863678	upstream	16317	A cross-population atlas of genetic associations for 220 human phenotypes.
2:176974104	Red blood cell count,	1.0E-9	rs863678	upstream	16317	A cross-population atlas of genetic associations for 220 human phenotypes.
2:176974104	Hematocrit,	2.0E-10	rs863678	upstream	16317	A cross-population atlas of genetic associations for 220 human phenotypes.
2:176974104	Estimated glomerular filtration rate (creatinine),	6.0E-20	rs863678	upstream	16317	Discovery and prioritization of variants and genes for kidney function in >1.2 million individuals.
2:176974104	Red blood cell count,	5.0E-26	rs863678	upstream	16317	The Polygenic and Monogenic Basis of Blood Traits and Diseases.
2:176974104	Hemoglobin,	2.0E-29	rs863678	upstream	16317	A cross-population atlas of genetic associations for 220 human phenotypes.
2:176974104	Red blood cell count,	7.0E-31	rs863678	upstream	16317	A cross-population atlas of genetic associations for 220 human phenotypes.
2:176974104	Hematocrit,	1.0E-34	rs863678	upstream	16317	A cross-population atlas of genetic associations for 220 human phenotypes.
2:176978383	Migraine,	5.0E-8	rs72923449	upstream	20596	Genome-wide analysis of 102,084 migraine cases identifies 123 risk loci and subtype-specific risk alleles.
2:176978833	Creatinine levels,	1.0E-18	rs711818	upstream	21046	Genetics of 35 blood and urine biomarkers in the UK Biobank.
2:176978833	Cystatin C levels,	1.0E-21	rs711818	upstream	21046	Genetics of 35 blood and urine biomarkers in the UK Biobank.
2:176978833	Estimated glomerular filtration rate,	2.0E-17	rs711818	upstream	21046	Genetics of 35 blood and urine biomarkers in the UK Biobank.
2:176981343	Amyotrophic lateral sclerosis (sporadic),	1.0E-6	rs7601234	upstream	23556	Genome-wide association study combining pathway analysis for typical sporadic amyotrophic lateral sclerosis in Chinese Han populations.
2:176982325	Serum levels of protein GIP,	3.0E-12	rs114841233	upstream	24538	A genome-wide association study of serum proteins reveals shared loci with common diseases.
2:176984544	Serum creatinine levels,	3.0E-31	rs72923454	upstream	26757	A cross-population atlas of genetic associations for 220 human phenotypes.
2:176991779	Magnesium levels,	5.0E-7	rs2592394	upstream	33992	Genome-wide association studies of serum magnesium, potassium, and sodium concentrations identify six Loci influencing serum magnesium levels.
2:176991779	Peripheral arterial disease (traffic-related air pollution interaction),	3.0E-6	rs2592394	upstream	33992	Genetic Variants in the Bone Morphogenic Protein Gene Family Modify the Association between Residential Exposure to Traffic and Peripheral Arterial Disease.
2:176991857	Balding type 1,	6.0E-38	rs71421546	upstream	34070	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
2:176991857	Male-pattern baldness,	2.0E-44	rs71421546	upstream	34070	Dissection of genetic variation and evidence for pleiotropy in male pattern baldness.
2:176991857	Male-pattern baldness,	3.0E-18	rs71421546	upstream	34070	Genetic prediction of male pattern baldness.
2:176991857	Male-pattern baldness,	1.0E-14	rs71421546	upstream	34070	GWAS for male-pattern baldness identifies 71 susceptibility loci explaining 38% of the risk.
2:176991857	Hair color,	8.0E-17	rs71421546	upstream	34070	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
2:176991924	Male-pattern baldness,	9.0E-10	rs6718516	upstream	34137	Dissection of genetic variation and evidence for pleiotropy in male pattern baldness.
2:176993583	Estimated glomerular filtration rate,	6.0E-30	rs187355703	upstream	35796	A catalog of genetic loci associated with kidney function from analyses of a million individuals.
2:176993583	Blood urea nitrogen levels,	3.0E-6	rs187355703	upstream	35796	A catalog of genetic loci associated with kidney function from analyses of a million individuals.
2:176993583	Chronic kidney disease,	3.0E-10	rs187355703	upstream	35796	A catalog of genetic loci associated with kidney function from analyses of a million individuals.
2:176993583	Urate levels,	3.0E-11	rs187355703	upstream	35796	Target genes, variants, tissues and transcriptional pathways influencing human serum urate levels.
2:176993583	Glomerular filtration rate (creatinine),	5.0E-10	rs187355703	upstream	35796	1000 Genomes-based meta-analysis identifies 10 novel loci for kidney function.
2:176993583	Estimated glomerular filtration rate,	1.0E-9	rs187355703	upstream	35796	Trans-ethnic kidney function association study reveals putative causal genes and effects on kidney-specific disease aetiologies.
2:176993583	Estimated glomerular filtration rate,	8.0E-30	rs187355703	upstream	35796	A catalog of genetic loci associated with kidney function from analyses of a million individuals.
2:176993583	Creatinine levels,	2.0E-31	rs187355703	upstream	35796	Genetics of 35 blood and urine biomarkers in the UK Biobank.
2:176993583	Estimated glomerular filtration rate,	4.0E-30	rs187355703	upstream	35796	Genetics of 35 blood and urine biomarkers in the UK Biobank.
2:176993583	Blood urea nitrogen levels,	1.0E-19	rs187355703	upstream	35796	Discovery and prioritization of variants and genes for kidney function in >1.2 million individuals.
2:176993583	Cystatin C levels,	1.0E-25	rs187355703	upstream	35796	Genetics of 35 blood and urine biomarkers in the UK Biobank.
2:176993583	Blood urea nitrogen levels,	7.0E-21	rs187355703	upstream	35796	A cross-population atlas of genetic associations for 220 human phenotypes.
2:176993583	Estimated glomerular filtration rate (creatinine),	9.0E-55	rs187355703	upstream	35796	Epigenomic and transcriptomic analyses define core cell types, genes and targetable mechanisms for kidney disease.
2:176993583	Estimated glomerular filtration rate (creatinine),	4.0E-25	rs187355703	upstream	35796	Discovery and prioritization of variants and genes for kidney function in >1.2 million individuals.
2:176993583	Estimated glomerular filtration rate (cystatin c),	6.0E-22	rs187355703	upstream	35796	Discovery and prioritization of variants and genes for kidney function in >1.2 million individuals.
2:176993583	Estimated glomerular filtration rate (creatinine),	3.0E-51	rs187355703	upstream	35796	Discovery and prioritization of variants and genes for kidney function in >1.2 million individuals.
2:176993583	Urate levels,	5.0E-20	rs187355703	upstream	35796	Genetics of 35 blood and urine biomarkers in the UK Biobank.
2:176993583	Serum uric acid levels,	1.0E-18	rs187355703	upstream	35796	A cross-population atlas of genetic associations for 220 human phenotypes.
2:176993583	Urea levels,	9.0E-21	rs187355703	upstream	35796	Genetics of 35 blood and urine biomarkers in the UK Biobank.
2:176993583	Creatinine levels,	2.0E-13	rs187355703	upstream	35796	Characterising metabolomic signatures of lipid-modifying therapies through drug target mendelian randomisation.
2:177004026	Pulse pressure,	1.0E-11	rs11888604	upstream	46239	A cross-population atlas of genetic associations for 220 human phenotypes.

Flanking region : 5 kb 10 kb 50 kb

Position	HGVS	dbSNP id	Phenotype List	Distance	Clinvar Significance
2:176940017	GRCh38/hg38 2q31.1(chr2:176075289-176156257)x1	NA	See cases	-17770	Pathogenic
2:176940017	GRCh38/hg38 2q31.1(chr2:176075289-176156257)x1	NA	See cases	-17770	Pathogenic
2:176945303	NM_001080458.2(EVX2):c.963C>G (p.Thr321=)	rs200844347	not provided	-12484	Benign
2:176950926	GRCh37/hg19 2q31.1(chr2:176950926-177047801)x3	NA	not provided	-6861	Benign
2:176951487	GRCh37/hg19 2q31.1(chr2:176951487-177070756)x3	NA	not provided	-6300	Benign
2:176951491	GRCh38/hg38 2q31.1-32.3(chr2:176086763-193201970)x1	NA	See cases	-6296	Pathogenic
2:176951491	GRCh38/hg38 2q31.1-32.3(chr2:176086763-193201970)x1	NA	See cases	-6296	Pathogenic
2:176955723	GRCh38/hg38 2q31.1(chr2:176090995-176108288)x3	NA	See cases	-2064	Uncertain significance
2:176955723	GRCh38/hg38 2q31.1(chr2:176090995-176108288)x3	NA	See cases	-2064	Uncertain significance
2:176957201	Single allele	NA	not provided	-586	Benign
2:176957230	Single allele	NA	not provided	-557	Benign
2:176957519	NM_000523.4(HOXD13):c.-100C>A	NA	not provided	-268	Likely benign
2:176957580	NM_000523.4(HOXD13):c.-39G>C	NA	not provided	-207	Benign
2:176957650	NM_000523.4(HOXD13):c.32G>C (p.Gly11Ala)	rs536639583	Synpolydactyly type 1\|not provided	-137	Uncertain significance
2:176957650	NM_000523.4(HOXD13):c.32G>C (p.Gly11Ala)	rs536639583	Synpolydactyly type 1\|not provided	-137	Uncertain significance
2:176957659	NM_000523.4(HOXD13):c.41C>T (p.Ala14Val)	rs555136684	not specified\|not provided	-128	Benign/Likely benign
2:176957694	NM_000523.4(HOXD13):c.78CTC[2] (p.Ser30del)	NA	not provided	-93	Uncertain significance
2:176957753	NM_000523.4(HOXD13):c.135C>T (p.Ser45=)	rs757175860	not provided	-34	Uncertain significance
2:176957781	NM_000523.4(HOXD13):c.164_184del (p.Gly55_Ala61del)	rs587776824	VACTERL association	-6	Uncertain significance
2:176957781	NM_000523.4(HOXD13):c.164_184del (p.Gly55_Ala61del)	rs587776824	VACTERL association	-6	Uncertain significance
2:176957785	NM_000523.4(HOXD13):c.168GGC[8] (p.Ala69_Ala71dup)	rs3832095	not provided	-2	Uncertain significance
2:176957785	NM_000523.4(HOXD13):c.168GGC[6] (p.Ala71dup)	NA	Brachydactyly-syndactyly syndrome	-2	Likely benign
2:176957785	NM_000523.4(HOXD13):c.186_212dup (p.Ala63_Ala71dup)	NA	not provided	-2	Pathogenic
2:176957785	NM_000523.4(HOXD13):c.167G>A (p.Arg56Gln)	NA	not provided	-2	Uncertain significance
2:176957786	NM_000523.4(HOXD13):c.183_206dup (p.Ala64_Ala71dup)	NA	not provided	-1	Pathogenic
2:176957786	NM_000523.4(HOXD13):c.168GGC[1] (p.Ala68_Ala71del)	NA	not provided	-1	Uncertain significance
2:176957788	NM_000523.4(HOXD13):c.170C>T (p.Ala57Val)	NA	not provided	1	Uncertain significance
2:176957790	NM_000523.4(HOXD13):c.183_203del (p.Ala65_Ala71del)	rs878854346	Brachydactyly-syndactyly syndrome	3	Pathogenic
2:176957790	NM_000523.4(HOXD13):c.183_203del (p.Ala65_Ala71del)	rs878854346	Brachydactyly-syndactyly syndrome	3	Pathogenic
2:176957793	NM_000523.4(HOXD13):c.183_191del (p.Ala69_Ala71del)	rs749930395	not specified\|not provided	6	Benign/Likely benign
2:176957802	NM_000523.4(HOXD13):c.192_200del (p.Ala69_Ala71del)	NA	not provided	15	Likely benign
2:176957820	NM_000523.4(HOXD13):c.202G>C (p.Ala68Pro)	NA	not provided	33	Uncertain significance
2:176957821	NM_000523.4(HOXD13):c.203_204insA (p.Ala69fs)	NA	not provided	34	Likely pathogenic
2:176957822	NM_000523.4(HOXD13):c.209_210insGGCTGCGGCGGCGGCAGCGGC (p.Ala65_Ala71dup)	rs878854345	Syndactyly type 5\|Synpolydactyly type 1	35	Pathogenic
2:176957822	NM_000523.4(HOXD13):c.204G>A (p.Ala68=)	rs2518053	not specified\|Syndactyly type 5\|not provided\|Synpolydactyly type 1\|Brachydactyly type E1\|Brachydactyly type D	35	Benign
2:176957822	NM_000523.4(HOXD13):c.209_210insGGCTGCGGCGGCGGCAGCGGC (p.Ala65_Ala71dup)	rs878854345	Syndactyly type 5\|Synpolydactyly type 1	35	Pathogenic
2:176957822	NM_000523.4(HOXD13):c.204G>A (p.Ala68=)	rs2518053	not specified\|Syndactyly type 5\|not provided\|Synpolydactyly type 1\|Brachydactyly type E1\|Brachydactyly type D	35	Benign
2:176957822	NM_000523.4(HOXD13):c.212_213insGGCGGCTGCGGCGGCGGCAGCGGCAGC (p.Ala63_Ala71dup)	rs775525473	Synpolydactyly type 1\|not provided	35	Pathogenic
2:176957835	NM_000523.4(HOXD13):c.217G>A (p.Gly73Ser)	rs544449825	Brachydactyly-syndactyly syndrome	48	Uncertain significance
2:176957859	NM_000523.4(HOXD13):c.241G>A (p.Glu81Lys)	NA	not provided	72	Uncertain significance
2:176957878	NM_000523.4(HOXD13):c.260C>G (p.Ser87Trp)	NA	not provided	91	Uncertain significance
2:176957885	NM_000523.4(HOXD13):c.267G>A (p.Ser89=)	rs772479524	not provided	98	Benign
2:176957914	NM_000523.4(HOXD13):c.296C>G (p.Pro99Arg)	rs143487752	not provided	127	Uncertain significance
2:176957931	NM_000523.4(HOXD13):c.314_315del (p.Lys105fs)	NA	not provided	144	Pathogenic
2:176957932	NM_000523.4(HOXD13):c.314A>C (p.Lys105Thr)	rs200514497	not provided	145	Benign/Likely benign
2:176957941	NM_000523.4(HOXD13):c.323_336del (p.Pro108fs)	rs878854343	Synpolydactyly type 1	154	Pathogenic
2:176957941	NM_000523.4(HOXD13):c.323_336del (p.Pro108fs)	rs878854343	Synpolydactyly type 1	154	Pathogenic
2:176958011	NM_000523.4(HOXD13):c.393C>T (p.Phe131=)	rs847195	not specified\|not provided	224	Benign
2:176958118	NM_000523.4(HOXD13):c.500A>G (p.Tyr167Cys)	rs200067774	not specified\|not provided	331	Conflicting interpretations of pathogenicity
2:176958118	NM_000523.4(HOXD13):c.500A>G (p.Tyr167Cys)	rs200067774	not specified\|not provided	331	Conflicting interpretations of pathogenicity
2:176958131	NM_000523.4(HOXD13):c.513A>G (p.Ser171=)	rs1221715617	not provided	344	Uncertain significance
2:176958156	NM_000523.4(HOXD13):c.542_552del (p.Asn181fs)	NA	not provided	369	Pathogenic
2:176958159	NM_000523.4(HOXD13):c.541A>G (p.Asn181Asp)	rs148979353	not specified	372	Likely benign
2:176958178	NM_000523.4(HOXD13):c.560C>G (p.Ala187Gly)	rs1431472260	not provided	391	Uncertain significance
2:176958191	NM_000523.4(HOXD13):c.575_577del (p.Phe192del)	rs1559108268	not provided	404	Uncertain significance
2:176958231	NM_000523.4(HOXD13):c.613G>A (p.Gly205Ser)	NA	not provided	444	Uncertain significance
2:176958235	NM_000523.4(HOXD13):c.617A>G (p.Tyr206Cys)	NA	not provided	448	Likely benign
2:176958241	NM_000523.4(HOXD13):c.623A>T (p.Asp208Val)	NA	Synpolydactyly type 1	454	Uncertain significance
2:176958292	NM_000523.4(HOXD13):c.674C>G (p.Ser225Cys)	rs367674921	not provided	505	Uncertain significance
2:176958301	NM_000523.4(HOXD13):c.683G>T (p.Gly228Val)	rs121912541	Synpolydactyly type 1	514	Pathogenic
2:176958301	NM_000523.4(HOXD13):c.683G>C (p.Gly228Ala)	rs121912541	Synpolydactyly type 1	514	Pathogenic
2:176958301	NM_000523.4(HOXD13):c.683G>T (p.Gly228Val)	rs121912541	Synpolydactyly type 1	514	Pathogenic
2:176958301	NM_000523.4(HOXD13):c.683G>C (p.Gly228Ala)	rs121912541	Synpolydactyly type 1	514	Pathogenic
2:176958326	NM_000523.4(HOXD13):c.708del (p.Asn236fs)	NA	Synpolydactyly type 1	539	Pathogenic
2:176958327	NM_000523.4(HOXD13):c.709G>C (p.Gly237Arg)	rs1689365853	Synpolydactyly type 1	540	Uncertain significance
2:176958359	NM_000523.4(HOXD13):c.744_747del (p.Gln248fs)	rs1574943406	Brachydactyly type E1;Brachydactyly type D;Synpolydactyly type 1;Syndactyly type 5	572	Pathogenic
2:176958360	NM_000523.4(HOXD13):c.742C>T (p.Gln248Ter)	rs878854400	Synpolydactyly type 1	573	Pathogenic
2:176958360	NM_000523.4(HOXD13):c.742C>T (p.Gln248Ter)	rs878854400	Synpolydactyly type 1	573	Pathogenic
2:176958400	NM_000523.4(HOXD13):c.781+1G>A	rs886037831	Synpolydactyly type 1	613	Pathogenic
2:176958400	NM_000523.4(HOXD13):c.781+1G>A	rs886037831	Synpolydactyly type 1	613	Pathogenic
2:176958450	NM_000523.4(HOXD13):c.781+51G>T	NA	not provided	663	Likely benign
2:176958701	NM_000523.4(HOXD13):c.781+302A>C	NA	not provided	914	Benign
2:176958962	NM_000523.4(HOXD13):c.782-246C>T	NA	not provided	1175	Benign
2:176959008	NM_000523.4(HOXD13):c.782-200A>G	NA	not provided	1221	Benign
2:176959079	NM_000523.4(HOXD13):c.782-129G>A	NA	not provided	1292	Benign
2:176959113	NM_000523.4(HOXD13):c.782-94CA[19]	NA	not provided	1326	Benign
2:176959113	NM_000523.4(HOXD13):c.782-94CA[17]	NA	not provided	1326	Benign
2:176959113	NM_000523.4(HOXD13):c.782-94CA[18]	NA	not provided	1326	Benign
2:176959114	NM_000523.4(HOXD13):c.782-94CA[15]	NA	not provided	1327	Likely benign
2:176959206	NM_000523.4(HOXD13):c.782-2del	rs764838478	Synpolydactyly type 1	1419	Pathogenic
2:176959206	NM_000523.4(HOXD13):c.782-2del	rs764838478	Synpolydactyly type 1	1419	Pathogenic
2:176959233	NM_000523.4(HOXD13):c.807C>T (p.Asp269=)	NA	not provided	1446	Likely benign
2:176959239	NM_000523.4(HOXD13):c.813C>T (p.Cys271=)	NA	not provided	1452	Likely benign
2:176959246	NM_000523.4(HOXD13):c.820C>T (p.Arg274Ter)	rs200750564	6 conditions\|not provided\|Inborn genetic diseases\|Synpolydactyly type 1\|Brachydactyly-syndactyly syndrome\|Synpolydactyly	1459	Pathogenic/Likely pathogenic
2:176959260	NM_000523.4(HOXD13):c.834del (p.Lys279fs)	rs878854344	Synpolydactyly type 1	1473	Pathogenic
2:176959260	NM_000523.4(HOXD13):c.834del (p.Lys279fs)	rs878854344	Synpolydactyly type 1	1473	Pathogenic
2:176959285	NM_000523.4(HOXD13):c.859C>A (p.Gln287Lys)	NA	not provided	1498	Uncertain significance
2:176959318	NM_000523.4(HOXD13):c.894_896del (p.Asn298del)	rs749985629	not provided	1531	Conflicting interpretations of pathogenicity
2:176959338	NM_000523.4(HOXD13):c.912C>G (p.Asp304Glu)	rs1553517346	not provided	1551	Uncertain significance
2:176959342	NM_000523.4(HOXD13):c.916C>T (p.Arg306Trp)	rs28933082	Synpolydactyly type 1	1555	Likely pathogenic
2:176959342	NM_000523.4(HOXD13):c.916C>G (p.Arg306Gly)	rs28933082	Synpolydactyly type 1	1555	Pathogenic
2:176959342	NM_000523.4(HOXD13):c.916C>T (p.Arg306Trp)	rs28933082	Synpolydactyly type 1	1555	Likely pathogenic
2:176959342	NM_000523.4(HOXD13):c.916C>G (p.Arg306Gly)	rs28933082	Synpolydactyly type 1	1555	Pathogenic
2:176959343	NM_000523.4(HOXD13):c.917G>A (p.Arg306Gln)	rs879255265	Synpolydactyly type 1	1556	Pathogenic
2:176959343	NM_000523.4(HOXD13):c.917G>A (p.Arg306Gln)	rs879255265	Synpolydactyly type 1	1556	Pathogenic
2:176959349	NM_000523.4(HOXD13):c.923G>A (p.Arg308His)	NA	not provided	1562	Uncertain significance
2:176959363	NM_000523.4(HOXD13):c.937A>C (p.Thr313Pro)	rs1301927745	Abnormality of finger	1576	Uncertain significance
2:176959373	NM_000523.4(HOXD13):c.947C>G (p.Ser316Cys)	rs28928892	Brachydactyly type E1\|Brachydactyly type D	1586	Pathogenic
2:176959373	NM_000523.4(HOXD13):c.947C>G (p.Ser316Cys)	rs28928892	Brachydactyly type E1\|Brachydactyly type D	1586	Pathogenic
2:176959378	NM_000523.4(HOXD13):c.952A>G (p.Arg318Gly)	NA	not provided	1591	Uncertain significance
2:176959390	NM_000523.4(HOXD13):c.964A>C (p.Ile322Leu)	rs28928891	Brachydactyly type E1\|Brachydactyly type D	1603	Pathogenic
2:176959390	NM_000523.4(HOXD13):c.964A>C (p.Ile322Leu)	rs28928891	Brachydactyly type E1\|Brachydactyly type D	1603	Pathogenic
2:176959399	NM_000523.4(HOXD13):c.973C>A (p.Gln325Lys)	rs875989842	Brachydactyly-syndactyly-oligodactyly syndrome	1612	Pathogenic
2:176959399	NM_000523.4(HOXD13):c.973C>A (p.Gln325Lys)	rs875989842	Brachydactyly-syndactyly-oligodactyly syndrome	1612	Pathogenic
2:176959400	NM_000523.4(HOXD13):c.974A>G (p.Gln325Arg)	rs104893635	Syndactyly type 5	1613	Pathogenic
2:176959400	NM_000523.4(HOXD13):c.974A>G (p.Gln325Arg)	rs104893635	Syndactyly type 5	1613	Pathogenic
2:176959769	NM_000523.4(HOXD13):c.*311C>T	NA	not provided	1982	Benign
2:176973657	NM_021192.3(HOXD11):c.804A>G (p.Lys268=)	rs142296120	not provided	15870	Likely benign
2:176973732	NM_021192.3(HOXD11):c.879A>G (p.Lys293=)	rs78492630	not provided	15945	Benign
2:176973807	NM_021192.3(HOXD11):c.954G>A (p.Arg318=)	rs138394594	not provided	16020	Benign
2:176981552	NM_002148.4(HOXD10):c.-10C>A	rs781377305	Congenital vertical talus	23765	Uncertain significance
2:176981556	NM_002148.4(HOXD10):c.-6C>G	rs538359875	Congenital vertical talus	23769	Uncertain significance
2:176981648	NM_002148.4(HOXD10):c.87C>T (p.Ser29=)	rs752887490	Congenital vertical talus	23861	Uncertain significance
2:176981677	NM_002148.4(HOXD10):c.116C>T (p.Pro39Leu)	rs886055157	Congenital vertical talus	23890	Uncertain significance
2:176981691	NM_002148.4(HOXD10):c.130G>A (p.Gly44Arg)	rs145541578	not specified	23904	Uncertain significance
2:176981827	NM_002148.4(HOXD10):c.266G>A (p.Arg89Gln)	rs374700658	Congenital vertical talus	24040	Likely benign
2:176981845	NM_002148.4(HOXD10):c.284C>A (p.Thr95Lys)	rs1064797272	not provided	24058	Uncertain significance
2:176981853	NM_002148.4(HOXD10):c.292G>A (p.Val98Ile)	rs760536872	not provided	24066	Uncertain significance
2:176981933	NM_002148.4(HOXD10):c.372T>G (p.Ile124Met)	rs149038150	Congenital vertical talus	24146	Benign
2:176981981	NM_002148.4(HOXD10):c.420C>G (p.Pro140=)	rs375702128	Congenital vertical talus	24194	Uncertain significance
2:176981990	NM_002148.4(HOXD10):c.429C>T (p.Asn143=)	rs1222562257	not specified	24203	Likely benign
2:176982026	NM_002148.4(HOXD10):c.465T>C (p.Ser155=)	rs141770128	Congenital vertical talus	24239	Benign
2:176982104	NM_002148.4(HOXD10):c.543C>A (p.Asn181Lys)	rs886055158	Congenital vertical talus	24317	Uncertain significance
2:176982122	NM_002148.4(HOXD10):c.561G>A (p.Lys187=)	rs143870330	Congenital vertical talus	24335	Uncertain significance
2:176982142	NM_002148.4(HOXD10):c.581A>G (p.Gln194Arg)	rs769981285	Congenital vertical talus	24355	Likely benign
2:176982184	NM_002148.4(HOXD10):c.623A>G (p.Gln208Arg)	rs575171191	Congenital vertical talus	24397	Likely benign
2:176982245	NM_002148.4(HOXD10):c.684G>C (p.Glu228Asp)	rs1378675941	Congenital vertical talus	24458	Uncertain significance
2:176982325	NM_002148.4(HOXD10):c.745+19G>A	rs114841233	not provided	24538	Benign
2:176983679	NM_002148.4(HOXD10):c.746-3T>C	rs56941395	not provided	25892	Benign
2:176983704	NM_002148.4(HOXD10):c.768A>C (p.Pro256=)	rs61740491	not provided	25917	Benign
2:176983722	NM_002148.4(HOXD10):c.786T>A (p.Thr262=)	rs755118732	Congenital vertical talus	25935	Uncertain significance
2:176983892	NM_002148.4(HOXD10):c.956T>A (p.Met319Lys)	rs104893634	Congenital vertical talus	26105	Pathogenic
2:176983892	NM_002148.4(HOXD10):c.956T>A (p.Met319Lys)	rs104893634	Congenital vertical talus	26105	Pathogenic
2:176983923	NM_002148.4(HOXD10):c.987G>C (p.Arg329=)	rs33913965	Congenital vertical talus\|not provided	26136	Benign
2:176983934	NM_002148.4(HOXD10):c.998T>C (p.Leu333Pro)	rs144160937	Congenital vertical talus	26147	Benign
2:176983961	NM_002148.4(HOXD10):c.*2T>C	rs116807022	Congenital vertical talus\|not provided	26174	Benign
2:176983980	NM_002148.4(HOXD10):c.*21C>T	rs570165195	Congenital vertical talus	26193	Uncertain significance
2:176983993	NM_002148.4(HOXD10):c.*34G>A	rs1689824324	Congenital vertical talus	26206	Uncertain significance
2:176984006	NM_002148.4(HOXD10):c.*47G>T	rs114746583	Congenital vertical talus	26219	Benign
2:176984014	NM_002148.4(HOXD10):c.*55G>T	rs61070787	Congenital vertical talus	26227	Benign
2:176984035	NM_002148.4(HOXD10):c.*76G>C	rs558709855	Congenital vertical talus	26248	Uncertain significance
2:176984042	NM_002148.4(HOXD10):c.*83G>A	rs1008365837	Congenital vertical talus	26255	Uncertain significance
2:176984163	NM_002148.4(HOXD10):c.*205TA[21]	rs6147035	Congenital vertical talus	26376	Uncertain significance
2:176984163	NM_002148.4(HOXD10):c.*205TA[23]	rs6147035	Congenital vertical talus	26376	Uncertain significance
2:176984163	NM_002148.4(HOXD10):c.*205TA[18]	rs6147035	Congenital vertical talus	26376	Uncertain significance
2:176984163	NM_002148.4(HOXD10):c.*205TA[17]	rs6147035	Congenital vertical talus	26376	Uncertain significance
2:176984164	NM_002148.4(HOXD10):c.*205TA[14]	rs6147035	Congenital vertical talus	26377	Uncertain significance
2:176984164	NM_002148.4(HOXD10):c.*205TA[13]	rs6147035	Congenital vertical talus	26377	Uncertain significance
2:176984167	NM_002148.4(HOXD10):c.*208A>G	rs867143553	Congenital vertical talus	26380	Uncertain significance
2:176984192	NM_002148.4(HOXD10):c.*233T>A	rs867263804	Congenital vertical talus	26405	Uncertain significance
2:176984192	NM_002148.4(HOXD10):c.*234AT[8]AAA[1]	NA	not provided	26405	Benign
2:176984194	NM_002148.4(HOXD10):c.*235delinsTATATATATATATATAT	rs886055161	Congenital vertical talus	26407	Uncertain significance
2:176984194	NM_002148.4(HOXD10):c.*235delinsTATATATATAT	rs886055161	Congenital vertical talus	26407	Uncertain significance
2:176984194	NM_002148.4(HOXD10):c.*235A>T	rs76652386	Congenital vertical talus	26407	Uncertain significance
2:176984229	NM_002148.4(HOXD10):c.*270G>A	rs779201977	Congenital vertical talus	26442	Uncertain significance
2:176984237	NM_002148.4(HOXD10):c.*278G>A	rs565659273	Congenital vertical talus	26450	Uncertain significance
2:176984238	NM_002148.4(HOXD10):c.*279G>A	rs150556295	Congenital vertical talus	26451	Benign
2:176984427	NM_002148.4(HOXD10):c.*468A>T	rs532592274	Congenital vertical talus	26640	Uncertain significance
2:176984454	NM_002148.4(HOXD10):c.*495A>T	rs13403839	Congenital vertical talus	26667	Benign
2:176984544	NM_002148.4(HOXD10):c.*585C>T	rs72923454	Congenital vertical talus	26757	Benign
2:176984602	NM_002148.4(HOXD10):c.*643C>T	rs552102680	Congenital vertical talus	26815	Benign
2:176987516	NM_014213.4(HOXD9):c.20G>C (p.Gly7Ala)	rs186057872	not provided	29729	Benign
2:176988765	NM_014213.4(HOXD9):c.921C>T (p.Asn307=)	rs35649704	not provided	30978	Benign
2:176989222	GRCh38/hg38 2q31.1(chr2:176124494-176124918)x3	NA	See cases	31435	Benign
2:176989222	GRCh38/hg38 2q31.1(chr2:176124494-176124918)x3	NA	See cases	31435	Benign

Position	Population	BlockLength (kb)	Distance	Location with respect to STR	No. of SNPs	SNPs in the Haploblock
2:176907917-176909705	EAS	1.789	-49870	downstream	3	rs1103830, rs75297008, rs259377,
2:176908341-176909451	AFR	1.111	-49446	downstream	2	rs75297008, rs7291706,
2:176909705-176911428	all_pop	1.724	-48082	downstream	5	rs2593775, rs540482538, rs1823204, rs1989554, rs11163365,
2:176910065-176911032	EAS	0.968	-47722	downstream	2	rs540482538, rs182320,
2:176911032-176911431	SAS	0.4	-46755	downstream	4	rs1823204, rs1989554, rs111633651, rs57138908,
2:176911265-176911431	AFR	0.167	-46522	downstream	3	rs1989554, rs111633651, rs57138908,
2:176911265-176911431	EAS	0.167	-46522	downstream	3	rs1989554, rs111633651, rs57138908,
2:176911505-176924891	all_pop	13.387	-46282	downstream	36	rs1971514, rs34577030, rs2593774, rs75883060, rs847191, rs847190, rs847189, rs2052618, rs847188, rs847187, rs847186, rs847185, rs847184, rs57754416, rs567423926, rs55869674, rs75843795, rs543787528, rs847183, rs847182, rs16863530, rs847181, rs847180, rs847179, rs847178, rs847177, rs72919052, rs10188710, rs847176, rs77648136, rs847175, rs55676894, rs72919058, rs147575323, rs1099942, rs86177,
2:176911929-176925393	EAS	13.465	-45858	downstream	32	rs147511866, rs34577030, rs2593774, rs75883060, rs847191, rs847190, rs847189, rs847188, rs847187, rs847186, rs847185, rs847184, rs567423926, rs55869674, rs543787528, rs847183, rs847182, rs16863530, rs847181, rs847180, rs847179, rs847178, rs847177, rs10188710, rs847176, rs847175, rs1099942, rs145571420, rs861771, rs545198423, rs847174, rs7302990,
2:176912372-176927529	SAS	15.158	-45415	downstream	46	rs139933624, rs2593774, rs192643438, rs558288333, rs187326945, rs75883060, rs373586293, rs847191, rs847190, rs145409102, rs847189, rs847188, rs847187, rs847186, rs847185, rs847184, rs367609042, rs567423926, rs55869674, rs187554218, rs543787528, rs847183, rs847182, rs16863530, rs847181, rs847180, rs146479573, rs847179, rs847178, rs847177, rs10188710, rs188551819, rs847176, rs192454161, rs847175, rs72919058, rs147575323, rs183891504, rs188898195, rs1099942, rs187209913, rs861771, rs545198423, rs847174, rs73029903, rs14634202,
2:176913386-176924789	AFR	11.404	-44401	downstream	33	rs2593774, rs847191, rs847190, rs847189, rs2052618, rs847188, rs847187, rs57754416, rs58152403, rs567423926, rs543787528, rs847182, rs72917083, rs16863530, rs847181, rs847180, rs847179, rs847178, rs847177, rs72919052, rs10188710, rs847176, rs73045885, rs77648136, rs11884354, rs847175, rs55676894, rs72919058, rs147575323, rs55754321, rs1099942, rs11892645, rs14970753,
2:176916214-176921784	AMR	5.571	-41573	downstream	22	rs112354731, rs57754416, rs567423926, rs55869674, rs75843795, rs543787528, rs72917079, rs847183, rs847182, rs16863530, rs847181, rs847180, rs847179, rs72917089, rs847178, rs847177, rs72919052, rs10188710, rs847176, rs72919057, rs77648136, rs84717,
2:176919959-176927667	EUR	7.709	-37828	downstream	17	rs10188710, rs847176, rs72919057, rs77648136, rs847175, rs148110003, rs114191146, rs55676894, rs72919058, rs147575323, rs1099942, rs72919060, rs861771, rs847174, rs73029903, rs17290602, rs1247455,
2:176922225-176924891	AMR	2.667	-35562	downstream	8	rs148110003, rs114191146, rs55676894, rs72919058, rs147575323, rs1099942, rs72919060, rs86177,
2:176924978-176925393	all_pop	0.416	-32809	downstream	3	rs545198423, rs847174, rs7302990,
2:176925393-176926376	AFR	0.984	-32394	downstream	2	rs73029903, rs7302990,
2:176928483-176929764	all_pop	1.282	-29304	downstream	4	rs72919066, rs7426104, rs79055742, rs1223308,
2:176928483-176932136	AMR	3.654	-29304	downstream	11	rs72919066, rs7426104, rs79055742, rs67860040, rs847132, rs79903578, rs111861018, rs1374755, rs2216864, rs847130, rs154220,
2:176928511-176936780	AFR	8.27	-29276	downstream	35	rs74537258, rs73029910, rs78199887, rs7426104, rs114387084, rs74990158, rs73029912, rs12233083, rs72919070, rs113431037, rs75627219, rs111273480, rs67860040, rs847132, rs847131, rs1374755, rs847130, rs1542208, rs58091531, rs847129, rs59010936, rs116390432, rs847128, rs79729767, rs72919076, rs112832343, rs77940081, rs7599822, rs1000032, rs113120206, rs711811, rs75460826, rs76568352, rs847127, rs7522417,
2:176928633-176933551	EAS	4.919	-29154	downstream	12	rs7426104, rs75228702, rs12233083, rs12619209, rs847132, rs79903578, rs1374755, rs2216864, rs847130, rs1542208, rs847129, rs7435774,
2:176928633-176928699	EUR	0.067	-29154	downstream	2	rs7426104, rs7905574,
2:176929979-176930828	all_pop	0.85	-27808	downstream	3	rs12619209, rs67860040, rs84713,
2:176931248-176932552	all_pop	1.305	-26539	downstream	6	rs79903578, rs1374755, rs2216864, rs847130, rs1542208, rs5809153,
2:176931248-176932012	EUR	0.765	-26539	downstream	4	rs79903578, rs1374755, rs2216864, rs84713,
2:176931248-176931950	SAS	0.703	-26539	downstream	3	rs79903578, rs1374755, rs221686,
2:176932012-176943331	SAS	11.32	-25775	downstream	19	rs847130, rs1542208, rs58091531, rs847129, rs74357740, rs76052028, rs711811, rs74501719, rs847127, rs847126, rs60035115, rs148295558, rs79985901, rs112997284, rs1155721, rs201489260, rs367824384, rs113240312, rs11665580,
2:176932552-176941481	AMR	8.93	-25235	downstream	11	rs58091531, rs847129, rs187337360, rs1000032, rs711811, rs1005532, rs847127, rs847126, rs60035115, rs79985901, rs115572,
2:176932552-176942991	EUR	10.44	-25235	downstream	13	rs58091531, rs847129, rs1000032, rs711811, rs1005532, rs847127, rs847126, rs60035115, rs79985901, rs1155721, rs78797704, rs75526278, rs11324031,
2:176932555-176941272	all_pop	8.718	-25232	downstream	12	rs847129, rs74357740, rs1000032, rs711811, rs1005532, rs74501719, rs847127, rs847126, rs60035115, rs79985901, rs61206863, rs11299728,
2:176935896-176959810	EAS	23.915	-21891	downstream	31	rs74501719, rs847127, rs847126, rs60035115, rs79985901, rs112997284, rs201489260, rs113240312, rs1868101, rs73029923, rs77597349, rs76494921, rs6758117, rs11888176, rs35158526, rs12474905, rs847202, rs73974635, rs73974637, rs66508389, rs6732069, rs59637648, rs79835123, rs847201, rs75955114, rs55691205, rs78368994, rs148568124, rs2518053, rs847194, rs14656499,
2:176937691-176944778	AFR	7.088	-20096	downstream	16	rs116666009, rs77154530, rs60035115, rs76693906, rs7578562, rs61206863, rs1155721, rs201489260, rs77887170, rs72919085, rs548147973, rs113240312, rs56737494, rs847142, rs78938216, rs7302992,
2:176941735-176945012	all_pop	3.278	-16052	downstream	6	rs201489260, rs78797704, rs75526278, rs113240312, rs73029921, rs186810,
2:176942040-176942464	AMR	0.425	-15747	downstream	2	rs78797704, rs7552627,
2:176942991-176945012	AMR	2.022	-14796	downstream	2	rs113240312, rs186810,
2:176945667-176947237	AFR	1.571	-12120	downstream	3	rs73029923, rs73029924, rs675811,
2:176945667-176947237	all_pop	1.571	-12120	downstream	3	rs73029923, rs76494921, rs675811,
2:176945667-176947237	SAS	1.571	-12120	downstream	3	rs73029923, rs76494921, rs675811,
2:176947411-176954496	AFR	7.086	-10376	downstream	22	rs77530638, rs61731351, rs72919092, rs58688656, rs72919095, rs6752623, rs35158526, rs76128413, rs847202, rs61086530, rs73029926, rs73974635, rs73974637, rs112690657, rs66508389, rs6732069, rs6760988, rs59637648, rs2593769, rs200745868, rs847201, rs1093072,
2:176948615-176957230	SAS	8.616	-9172	downstream	27	rs375157835, rs6752623, rs11888176, rs35158526, rs12474905, rs146148996, rs847202, rs61086530, rs73974635, rs73974637, rs66508389, rs6732069, rs59637648, rs79835123, rs847201, rs10930722, rs75955114, rs847200, rs55691205, rs78368994, rs847198, rs3754983, rs113826400, rs113236238, rs847196, rs115691165, rs11314397,
2:176950926-176957230	all_pop	6.305	-6861	downstream	25	rs6752623, rs11888176, rs35158526, rs12474905, rs847202, rs61086530, rs73974635, rs73974637, rs66508389, rs6732069, rs59637648, rs79835123, rs847201, rs10930722, rs75955114, rs847200, rs55691205, rs78368994, rs847198, rs3754983, rs113236238, rs847196, rs114813623, rs115691165, rs11314397,
2:176950926-176957230	AMR	6.305	-6861	downstream	21	rs6752623, rs35158526, rs12474905, rs847202, rs61086530, rs73974635, rs73974637, rs66508389, rs6732069, rs59637648, rs847201, rs10930722, rs847200, rs55691205, rs847198, rs3754983, rs113826400, rs113236238, rs847196, rs115691165, rs11314397,
2:176950926-176957230	EUR	6.305	-6861	downstream	21	rs6752623, rs35158526, rs12474905, rs847202, rs61086530, rs73974635, rs73974637, rs66508389, rs6732069, rs59637648, rs847201, rs10930722, rs847200, rs55691205, rs847198, rs3754983, rs113826400, rs113236238, rs847196, rs115691165, rs11314397,
2:176955545-176956510	AFR	0.966	-2242	downstream	4	rs847200, rs847199, rs847198, rs375498,
2:176956704-176960989	AFR	4.286	-1083	downstream	13	rs114713005, rs847196, rs73029933, rs114813623, rs115691165, rs113143979, rs144577020, rs2518053, rs847195, rs847194, rs847193, rs847192, rs11587054,
2:176959810-176970877	all_pop	11.068	2023	upstream	25	rs146564993, rs847158, rs847157, rs847156, rs847155, rs847154, rs847153, rs847152, rs56094526, rs711812, rs847151, rs35817516, rs711813, rs11356868, rs847150, rs16863549, rs741610, rs711814, rs113865045, rs72923436, rs847148, rs847147, rs149153219, rs59898108, rs5989139,
2:176962102-176962580	AFR	0.479	4315	upstream	4	rs847158, rs847157, rs847156, rs84715,
2:176962102-176971968	AMR	9.867	4315	upstream	25	rs847158, rs847157, rs847156, rs847155, rs847154, rs847153, rs847152, rs56094526, rs711812, rs847151, rs35817516, rs711813, rs11356868, rs847150, rs16863549, rs741610, rs711814, rs113865045, rs72923436, rs847148, rs847147, rs149153219, rs59898108, rs59891395, rs11369638,
2:176962102-176970456	EAS	8.355	4315	upstream	16	rs847158, rs847157, rs847156, rs847155, rs847154, rs847153, rs847152, rs711812, rs847151, rs711813, rs11356868, rs847150, rs16863549, rs741610, rs711814, rs84714,
2:176962102-176970877	SAS	8.776	4315	upstream	23	rs847158, rs847157, rs847156, rs847155, rs847154, rs847153, rs847152, rs56094526, rs711812, rs847151, rs35817516, rs711813, rs11356868, rs847150, rs16863549, rs741610, rs711814, rs140360801, rs3813811, rs847148, rs847147, rs59898108, rs5989139,
2:176962276-176972916	EUR	10.641	4489	upstream	25	rs113800658, rs847157, rs847156, rs847155, rs847154, rs847153, rs847152, rs56094526, rs711812, rs847151, rs35817516, rs711813, rs11356868, rs847150, rs16863549, rs741610, rs711814, rs113865045, rs72923436, rs847148, rs847147, rs149153219, rs59898108, rs59891395, rs54593636,
2:176962695-176973082	AFR	10.388	4908	upstream	25	rs116640605, rs847154, rs847153, rs847152, rs114732862, rs115089141, rs711812, rs847151, rs116739197, rs74973103, rs711813, rs11356868, rs116041659, rs76571245, rs847150, rs741610, rs711814, rs113865045, rs72923436, rs847148, rs847147, rs149153219, rs59898108, rs59891395, rs84714,
2:176972916-176973082	all_pop	0.167	15129	upstream	2	rs545936360, rs84714,
2:176972916-176973082	AMR	0.167	15129	upstream	2	rs545936360, rs84714,
2:176972916-176973082	SAS	0.167	15129	upstream	2	rs545936360, rs84714,
2:176973082-176974104	EUR	1.023	15295	upstream	2	rs847146, rs86367,
2:176974104-176974122	all_pop	0.019	16317	upstream	2	rs863678, rs674576,
2:176974104-176976873	AMR	2.77	16317	upstream	5	rs863678, rs6745764, rs711815, rs2551808, rs255180,
2:176974104-176974122	EAS	0.019	16317	upstream	2	rs863678, rs674576,
2:176974104-176974122	SAS	0.019	16317	upstream	2	rs863678, rs674576,
2:176975183-176978401	all_pop	3.219	17396	upstream	10	rs847145, rs711815, rs818629, rs113601842, rs2551808, rs2551809, rs10754985, rs4972803, rs711817, rs7996091,
2:176975444-176983598	AFR	8.155	17657	upstream	24	rs847144, rs147477105, rs711815, rs546395343, rs818629, rs547146666, rs711816, rs113601842, rs2551808, rs2551809, rs10754985, rs6757956, rs711817, rs114805641, rs7609360, rs114870091, rs711818, rs116804034, rs6709104, rs116613515, rs111946226, rs60447410, rs7601234, rs14315108,
2:176975879-176983598	SAS	7.72	18092	upstream	12	rs72923440, rs711815, rs2551808, rs2551809, rs10754985, rs4972803, rs79960917, rs711818, rs6709104, rs60447410, rs7601234, rs14315108,
2:176975973-176978833	EAS	2.861	18186	upstream	6	rs711815, rs1026033, rs2551808, rs2551809, rs79960917, rs71181,
2:176975973-176983598	EUR	7.626	18186	upstream	12	rs711815, rs149252153, rs2551808, rs2551809, rs10754985, rs4972803, rs711818, rs6709104, rs113742463, rs7601234, rs149472645, rs14315108,
2:176977027-176984454	AMR	7.428	19240	upstream	9	rs10754985, rs4972803, rs711818, rs6709104, rs60447410, rs7601234, rs149472645, rs143151088, rs1340383,
2:176978833-176983586	all_pop	4.754	21046	upstream	6	rs711818, rs6709104, rs111946226, rs60447410, rs7601234, rs373179,
2:176981338-176983610	EAS	2.273	23551	upstream	4	rs60447410, rs75483960, rs3731792, rs7794600,
2:176983598-176983610	all_pop	0.013	25811	upstream	2	rs143151088, rs7794600,
2:176983610-176984454	AFR	0.845	25823	upstream	5	rs77946005, rs551630528, rs57933444, rs61070787, rs1340383,
2:176984180-176984454	all_pop	0.275	26393	upstream	2	rs143734503, rs1340383,
2:176985696-176988412	all_pop	2.717	27909	upstream	5	rs711819, rs711820, rs10445765, rs711821, rs69825,
2:176985696-176987220	AMR	1.525	27909	upstream	3	rs711819, rs711820, rs1044576,
2:176985696-176994623	EUR	8.928	27909	upstream	14	rs711819, rs711820, rs10445765, rs62188694, rs711822, rs711823, rs2592394, rs6718273, rs6718516, rs3903119, rs847164, rs28367532, rs711825, rs84716,
2:176985696-176992443	SAS	6.748	27909	upstream	11	rs711819, rs711820, rs10445765, rs62188694, rs711822, rs711823, rs2592394, rs6718273, rs6718516, rs861770, rs390311,
2:176986262-176988015	AFR	1.754	28475	upstream	3	rs111277941, rs10445765, rs71182,
2:176987112-176990539	EAS	3.428	29325	upstream	5	rs711820, rs10445765, rs62188694, rs711822, rs71182,
2:176988015-176988412	AMR	0.398	30228	upstream	2	rs711821, rs69825,
2:176988412-176988765	AFR	0.354	30625	upstream	2	rs698258, rs3564970,
2:176989020-176990539	all_pop	1.52	31233	upstream	3	rs62188694, rs711822, rs71182,
2:176989020-176990539	AMR	1.52	31233	upstream	3	rs62188694, rs711822, rs71182,
2:176989023-176990539	AFR	1.517	31236	upstream	2	rs711822, rs71182,
2:176990573-176992443	AFR	1.871	32786	upstream	7	rs711824, rs59406940, rs2592394, rs6718273, rs6718516, rs861770, rs390311,
2:176990573-176992443	all_pop	1.871	32786	upstream	6	rs711824, rs2592394, rs6718273, rs6718516, rs861770, rs390311,
2:176990573-176995902	AMR	5.33	32786	upstream	13	rs711824, rs2592394, rs6718273, rs6718516, rs861770, rs3903119, rs847164, rs28367532, rs711825, rs847163, rs847162, rs7580746, rs383510,
2:176990573-177009481	EAS	18.909	32786	upstream	46	rs711824, rs2592394, rs6718273, rs6718516, rs861770, rs3903119, rs847164, rs28367532, rs711825, rs847163, rs847162, rs7580746, rs3765049, rs3835104, rs370607203, rs3058727, rs711826, rs1868102, rs2113564, rs2113563, rs711827, rs3214495, rs711828, rs11890810, rs1348808, rs12988588, rs76652183, rs711829, rs3731795, rs79025511, rs4078756, rs72927149, rs144209960, rs79120932, rs58486577, rs1348807, rs67435554, rs10186211, rs76363873, rs10188827, rs79440139, rs6736786, rs57261027, rs7560206, rs7574396, rs1138642,
2:176992527-176995262	AFR	2.736	34740	upstream	5	rs28367532, rs711825, rs847162, rs192755857, rs758074,
2:176992527-176995262	all_pop	2.736	34740	upstream	5	rs28367532, rs711825, rs847163, rs847162, rs758074,
2:176992527-176995262	SAS	2.736	34740	upstream	5	rs28367532, rs711825, rs847163, rs847162, rs758074,
2:176998676-177004583	all_pop	5.908	40889	upstream	19	rs3058727, rs711826, rs1868102, rs2113564, rs2113563, rs711827, rs3214495, rs711828, rs11890810, rs1348808, rs12988588, rs76652183, rs711829, rs3731795, rs79025511, rs11888604, rs4078756, rs73033738, rs7303373,
2:176998676-177001056	AMR	2.381	40889	upstream	10	rs3058727, rs711826, rs1868102, rs2113564, rs2113563, rs711827, rs3214495, rs711828, rs11890810, rs1298858,
2:176998676-177004026	EUR	5.351	40889	upstream	11	rs3058727, rs1868102, rs2113564, rs2113563, rs711827, rs3214495, rs711828, rs11890810, rs12988588, rs711829, rs1188860,
2:176998676-177004115	SAS	5.44	40889	upstream	17	rs3058727, rs711826, rs1868102, rs2113564, rs2113563, rs711827, rs3214495, rs711828, rs11890810, rs1348808, rs12988588, rs76652183, rs711829, rs3731795, rs79025511, rs11888604, rs407875,
2:176998822-177004026	AFR	5.205	41035	upstream	12	rs711826, rs1868102, rs2113564, rs2113563, rs711827, rs114704366, rs3214495, rs79758129, rs11890810, rs74372405, rs12988588, rs1188860,
2:177001292-177009481	AMR	8.19	43505	upstream	15	rs711829, rs11888604, rs72927149, rs58486577, rs1348807, rs57174931, rs67435554, rs10186211, rs10188827, rs34526934, rs6736786, rs57261027, rs7560206, rs7574396, rs1138642,
2:177004492-177004583	AFR	0.092	46705	upstream	2	rs73033738, rs7303373,
2:177004689-177011655	all_pop	6.967	46902	upstream	22	rs72927149, rs144209960, rs79120932, rs58486577, rs1348807, rs141617282, rs57174931, rs67435554, rs10186211, rs76363873, rs10188827, rs34526934, rs79440139, rs6736786, rs57261027, rs7560206, rs7574396, rs11386425, rs11903220, rs11897797, rs55799551, rs1019683,
2:177004689-177010551	EUR	5.863	46902	upstream	15	rs72927149, rs58486577, rs1348807, rs57174931, rs10186211, rs10188827, rs34526934, rs6736786, rs57261027, rs7560206, rs7574396, rs11386425, rs11903220, rs11897797, rs5579955,
2:177004862-177005519	SAS	0.658	47075	upstream	2	rs144209960, rs7912093,
2:177005615-177005757	AFR	0.143	47828	upstream	2	rs58486577, rs134880,
2:177005615-177010142	SAS	4.528	47828	upstream	16	rs58486577, rs1348807, rs57174931, rs67435554, rs10186211, rs76363873, rs10188827, rs34526934, rs79440139, rs6736786, rs57261027, rs7560206, rs7574396, rs11386425, rs11903220, rs1189779,
2:177006290-177010142	AFR	3.853	48503	upstream	14	rs141617282, rs57174931, rs66482211, rs67435554, rs10186211, rs34526934, rs79440139, rs6736786, rs57261027, rs7560206, rs7574396, rs11386425, rs11903220, rs1189779,

No Alu found near the repeat

Conservation score was not calculated