STRIDE-DB

Repeat Length	AFR	AMR	EUR	EAS	SAS	Repeat
9.7	293	135	258	140	419	CCGCCACCGCCGCCGCCGCCGCCGCCGCC
0.7	2	0	0	0	3	CC
1.7	0	0	0	0	1	CCGCC
2.7	0	4	0	0	1	CCGCCACC
4.7	0	1	0	0	1	CCGCCACCGCCGCC
5.7	0	2	0	0	1	CCGCCACCGCCGCCGCC
6.7	0	2	0	0	8	CCGCCACCGCCGCCGCCGCC
7.3	0	0	0	0	2	CCGCCACCGCCGCCGCCGCCGC
7.7	2	1	0	0	9	CCGCCACCGCCGCCGCCGCCGCC
8.7	38	4	6	1	19	CCGCCACCGCCGCCGCCGCCGCCGCC
9.0	0	2	0	0	2	CCGCCACCGCCGCCGCCGCCGCCGCCG
10.0	1	0	0	0	0	CCGCCACCGCCGCCGCCGCCGCCGCCGCCG
10.7	19	4	25	0	5	CCGCCACCGCCGCCGCCGCCGCCGCCGCCGCC
11.7	33	7	9	1	41	CCGCCACCGCCGCCGCCGCCGCCGCCGCCGCCGCC
12.7	2	0	2	0	0	CCGCCACCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCC
13.7	0	2	0	0	0	CCGCCACCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCC

Position	Disease/Trait	P-value	SNPs	Location with respect to STR	distance	Study
4:3030097	Mean platelet volume,	1.0E-9	rs3775065	downstream	-46570	The Polygenic and Monogenic Basis of Blood Traits and Diseases.
4:3041938	Household income (MTAG),	7.0E-9	rs2798304	downstream	-34729	Genome-wide analysis identifies molecular systems and 149 genetic loci associated with income.
4:3051940	Neutrophil count,	3.0E-15	rs1263309	downstream	-24727	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
4:3052825	Neutrophil count,	8.0E-18	rs1313766	downstream	-23842	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
4:3057908	Myocardial infarction,	5.0E-6	rs1313771	downstream	-18759	Genome-wide analysis identifies novel susceptibility loci for myocardial infarction.
4:3064004	Sex hormone-binding globulin levels,	3.0E-15	rs2798297	downstream	-12663	Genetic evidence for different adiposity phenotypes and their opposing influence on ectopic fat and risk of cardiometabolic disease.
4:3064004	Triglycerides,	1.0E-12	rs2798297	downstream	-12663	Genetic evidence for different adiposity phenotypes and their opposing influence on ectopic fat and risk of cardiometabolic disease.
4:3064004	Alanine aminotransferase levels,	6.0E-7	rs2798297	downstream	-12663	Genetic evidence for different adiposity phenotypes and their opposing influence on ectopic fat and risk of cardiometabolic disease.
4:3064004	Body fat percentage,	3.0E-11	rs2798297	downstream	-12663	Genetic evidence for different adiposity phenotypes and their opposing influence on ectopic fat and risk of cardiometabolic disease.
4:3064004	Metabolic biomarkers (multivariate analysis),	1.0E-24	rs2798297	downstream	-12663	Genetic evidence for different adiposity phenotypes and their opposing influence on ectopic fat and risk of cardiometabolic disease.
4:3064004	Neutrophil percentage of white cells,	5.0E-9	rs2798297	downstream	-12663	The Polygenic and Monogenic Basis of Blood Traits and Diseases.
4:3074795	Estimated glomerular filtration rate (creatinine),	1.0E-9	rs762855	downstream	-1872	Epigenomic and transcriptomic analyses define core cell types, genes and targetable mechanisms for kidney disease.
4:3089564	Parental lifespan,	6.0E-9	rs61348208	upstream	12897	Genomics of 1 million parent lifespans implicates novel pathways and common diseases and distinguishes survival chances.
4:3089564	Aging traits (healthspan, parental lifespan or longevity) (multivariate analysis),	3.0E-8	rs61348208	upstream	12897	Multivariate genomic scan implicates novel loci and haem metabolism in human ageing.
4:3098321	Triglycerides to total lipids ratio in small LDL,	7.0E-9	rs7659144	upstream	21654	Characterising metabolomic signatures of lipid-modifying therapies through drug target mendelian randomisation.
4:3098321	Free cholesterol to total lipids ratio in small LDL,	2.0E-9	rs7659144	upstream	21654	Characterising metabolomic signatures of lipid-modifying therapies through drug target mendelian randomisation.
4:3098321	Free cholesterol to total lipids ratio in small VLDL,	2.0E-8	rs7659144	upstream	21654	Characterising metabolomic signatures of lipid-modifying therapies through drug target mendelian randomisation.
4:3098321	Phospholipids to total lipids ratio in small VLDL,	2.0E-8	rs7659144	upstream	21654	Characterising metabolomic signatures of lipid-modifying therapies through drug target mendelian randomisation.
4:3098321	Hip circumference adjusted for BMI,	5.0E-8	rs7659144	upstream	21654	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
4:3104568	White blood cell count,	8.0E-14	rs2024115	upstream	27901	The Polygenic and Monogenic Basis of Blood Traits and Diseases.
4:3104568	Neutrophil count,	5.0E-13	rs2024115	upstream	27901	The Polygenic and Monogenic Basis of Blood Traits and Diseases.
4:3105200	White blood cell count,	1.0E-17	rs73191188	upstream	28533	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
4:3105200	White blood cell count,	2.0E-15	rs73191188	upstream	28533	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
4:3105200	Neutrophil count,	3.0E-17	rs73191188	upstream	28533	A cross-population atlas of genetic associations for 220 human phenotypes.
4:3112109	Waist-to-hip ratio adjusted for BMI,	1.0E-8	rs55962025	upstream	35442	Shared Genetic and Experimental Links between Obesity-Related Traits and Asthma Subtypes in UK Biobank.
4:3112109	Waist-hip ratio,	6.0E-8	rs55962025	upstream	35442	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
4:3112109	Parental longevity (mother's age at death),	2.0E-6	rs55962025	upstream	35442	Human longevity is influenced by many genetic variants: evidence from 75,000 UK Biobank participants.
4:3116332	Itch intensity from mosquito bite adjusted by bite size,	8.0E-6	rs76778080	upstream	39665	GWAS of self-reported mosquito bite size, itch intensity and attractiveness to mosquitoes implicates immune-related predisposition loci.

Flanking region : 5 kb 10 kb 50 kb

Position	HGVS	dbSNP id	Phenotype List	Distance	Clinvar Significance
4:3035630	GRCh37/hg19 4p16.3(chr4:3035630-3515998)x3	NA	not provided	-41037	Uncertain significance
4:3074877	NM_002111.6(HTT):c.52CAG[?_25]	NA	Huntington disease	-1790	Benign
4:3074877	NM_002111.8(HTT):c.52CAG[27_35] (p.Gln18_Gln38delinsGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)	NA	Huntington disease	-1790	Pathogenic
4:3074877	NM_002111.8(HTT):c.52CAG[(36_39)]	NA	Huntington disease	-1790	Pathogenic
4:3074929	NM_001388492.1(HTT):c.110A>C (p.Gln37Pro)	rs587777899	not provided	-1738	not provided
4:3074935	NC_000004.11:g.3076606GCA[(40_?)]	NA	Huntington disease	-1732	Pathogenic
4:3076603	NM_001388492.1(HTT):c.54GCA[27] (p.Gln31_Gln38dup)	NA	not provided	-64	Uncertain significance
4:3076603	NM_001388492.1(HTT):c.54GCA[26] (p.Gln32_Gln38dup)	NA	not specified\|not provided	-64	Benign/Likely benign
4:3076603	NM_001388492.1(HTT):c.54GCA[22] (p.Gln36_Gln38dup)	NA	Huntington disease	-64	Uncertain significance
4:3076603	NM_001388492.1(HTT):c.54GCA[40] (p.Gln18_Gln38dup)	NA	Huntington disease	-64	Likely pathogenic
4:3076603	NM_001388492.1(HTT):c.54GCA[25] (p.Gln33_Gln38dup)	NA	See cases	-64	Benign
4:3076604	NC_000004.11:g.3076606GCA[(40_?)]	NA	Huntington disease	-63	Pathogenic
4:3076604	NM_002111.6(HTT):c.52CAG[?_25]	NA	Huntington disease	-63	Benign
4:3076604	NM_002111.8(HTT):c.52CAG[(36_39)]	NA	Huntington disease	-63	Pathogenic
4:3076604	NM_002111.8(HTT):c.52CAG[27_35] (p.Gln18_Gln38delinsGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)	NA	Huntington disease	-63	Pathogenic
4:3076604	NC_000004.11:g.3076606GCA[(40_?)]	NA	Huntington disease	-63	Pathogenic
4:3076604	NM_002111.6(HTT):c.52CAG[?_25]	NA	Huntington disease	-63	Benign
4:3076604	NM_002111.8(HTT):c.52CAG[27_35] (p.Gln18_Gln38delinsGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)	NA	Huntington disease	-63	Pathogenic
4:3076604	NM_002111.8(HTT):c.52CAG[(36_39)]	NA	Huntington disease	-63	Pathogenic
4:3076604	NM_001388492.1(HTT):c.58_110= (p.Gln20_Gln37=)	NA	not provided\|not specified	-63	Benign/Likely benign
4:3076606	NC_000004.11:g.3076606GCA[36_39]	NA	Huntington disease	-61	other
4:3076606	NC_000004.11:g.3076606GCA[(?_26)]	NA	Huntington disease	-61	Benign
4:3076606	NC_000004.11:g.3076606GCA[27_35]	NA	Huntington disease	-61	other
4:3076639	NM_001388492.1(HTT):c.54GCA[13] (p.Gln33_Gln38del)	rs1712396191	Huntington disease	-28	Likely benign
4:3076651	NM_001388492.1(HTT):c.105_106del (p.Gln36fs)	rs751281707	not specified	-16	Benign
4:3076654	NM_001388492.1(HTT):c.54GCA[18] (p.Gln38del)	rs754481229	not specified	-13	Benign
4:3076656	NM_001388492.1(HTT):c.110A>C (p.Gln37Pro)	rs587777899	not provided	-11	not provided
4:3076656	NM_001388492.1(HTT):c.110A>C (p.Gln37Pro)	rs587777899	not provided	-11	not provided
4:3076672	NM_001388492.1(HTT):c.123GCC[8] (p.Pro49dup)	rs772429544	not specified	5	Benign
4:3088647	NM_001388492.1(HTT):c.264-17_264-14del	NA	not provided	11980	Likely benign
4:3088649	NM_001388492.1(HTT):c.264-9dup	NA	not provided	11982	Benign
4:3088684	NM_001388492.1(HTT):c.282T>C (p.Ala94=)	NA	not provided	12017	Likely benign
4:3088697	NM_001388492.1(HTT):c.295C>G (p.Arg99Gly)	NA	not provided	12030	Uncertain significance
4:3088697	NM_001388492.1(HTT):c.295C>T (p.Arg99Cys)	NA	not provided	12030	Uncertain significance
4:3088720	NM_001388492.1(HTT):c.318A>C (p.Ile106=)	NA	not provided	12053	Benign
4:3088763	NM_001388492.1(HTT):c.347+14G>A	NA	not provided	12096	Likely benign
4:3100981	NC_000004.11:g.(?_3100981)_(3241786_?)dup	NA	not provided	24314	Uncertain significance
4:3101008	NM_001388492.1(HTT):c.355C>T (p.Pro119Ser)	NA	not provided	24341	Uncertain significance
4:3101010	NM_001388492.1(HTT):c.357A>G (p.Pro119=)	NA	not provided	24343	Likely benign
4:3101038	NM_001388492.1(HTT):c.385A>G (p.Met129Val)	NA	not provided	24371	Uncertain significance
4:3101063	NM_001388492.1(HTT):c.410A>G (p.Asp137Gly)	NA	not provided	24396	Uncertain significance
4:3101086	NM_001388492.1(HTT):c.433A>G (p.Met145Val)	NA	not provided	24419	Uncertain significance
4:3101097	NM_001388492.1(HTT):c.444C>T (p.Asp148=)	NA	not provided	24430	Likely benign
4:3101132	NM_001388492.1(HTT):c.468+11T>A	NA	not provided	24465	Likely benign
4:3105586	NM_001388492.1(HTT):c.504C>T (p.Leu168=)	NA	not provided	28919	Benign
4:3105604	NM_001388492.1(HTT):c.522T>A (p.Ile174=)	NA	not provided	28937	Likely benign
4:3105617	NM_001388492.1(HTT):c.528+7C>G	NA	not provided	28950	Benign
4:3105617	NM_001388492.1(HTT):c.528+7C>T	NA	not provided	28950	Likely benign
4:3107081	NM_001388492.1(HTT):c.529-3C>T	NA	not provided	30414	Likely benign
4:3107140	NM_001388492.1(HTT):c.585C>T (p.His195=)	NA	not provided	30473	Likely benign
4:3107149	NM_001388492.1(HTT):c.594G>A (p.Arg198=)	NA	not provided	30482	Likely benign
4:3107169	NM_001388492.1(HTT):c.608+7del	NA	not provided	30502	Likely benign
4:3107171	NM_001388492.1(HTT):c.608+8G>T	NA	not provided	30504	Likely benign
4:3109022	NM_001388492.1(HTT):c.619G>C (p.Val207Leu)	NA	not provided	32355	Uncertain significance
4:3109063	NM_001388492.1(HTT):c.660C>T (p.Pro220=)	NA	not provided	32396	Likely benign
4:3109075	NM_001388492.1(HTT):c.672C>T (p.Val224=)	NA	not provided	32408	Likely benign
4:3109095	NM_001388492.1(HTT):c.692C>T (p.Ala231Val)	NA	not provided	32428	Likely benign
4:3109154	NM_001388492.1(HTT):c.747+4del	NA	not provided	32487	Uncertain significance
4:3117013	NM_001388492.1(HTT):c.748-18G>A	NA	not provided	40346	Likely benign
4:3117017	NM_001388492.1(HTT):c.748-14T>G	NA	not provided	40350	Likely benign
4:3117026	NM_001388492.1(HTT):c.748-5C>T	NA	not provided	40359	Likely benign
4:3117027	NM_001388492.1(HTT):c.748-4G>A	NA	not provided	40360	Likely benign
4:3117075	NM_001388492.1(HTT):c.792C>A (p.Pro264=)	NA	not provided	40408	Likely benign
4:3117092	NM_001388492.1(HTT):c.809C>T (p.Ala270Val)	NA	not provided	40425	Uncertain significance
4:3117168	NM_001388492.1(HTT):c.885C>G (p.Leu295=)	NA	not provided	40501	Benign
4:3117178	NM_001388492.1(HTT):c.889+6G>T	NA	not provided	40511	Uncertain significance
4:3117181	NM_001388492.1(HTT):c.889+9G>A	NA	not provided	40514	Likely benign
4:3117186	NM_001388492.1(HTT):c.889+14A>G	NA	not provided	40519	Likely benign
4:3117188	NM_001388492.1(HTT):c.889+16A>G	NA	not provided	40521	Uncertain significance
4:3117828	NM_001388492.1(HTT):c.906C>A (p.Val302=)	NA	not provided	41161	Benign
4:3117828	NM_001388492.1(HTT):c.906C>G (p.Val302=)	NA	not provided	41161	Likely benign
4:3117842	NM_001388492.1(HTT):c.920C>T (p.Ser307Phe)	NA	not provided	41175	Uncertain significance
4:3117857	NM_001388492.1(HTT):c.935T>C (p.Leu312Pro)	NA	not provided	41190	Uncertain significance
4:3117861	NM_001388492.1(HTT):c.939C>T (p.Gly313=)	NA	not provided	41194	Likely benign
4:3117936	NM_001388492.1(HTT):c.1014C>T (p.Phe338=)	NA	not provided	41269	Likely benign
4:3117939	NM_001388492.1(HTT):c.1017A>C (p.Gly339=)	NA	not provided	41272	Likely benign
4:3117970	NM_001388492.1(HTT):c.1048T>G (p.Ser350Ala)	NA	not provided	41303	Uncertain significance
4:3117972	NM_001388492.1(HTT):c.1050T>C (p.Ser350=)	NA	not provided	41305	Likely benign
4:3118001	NM_001388492.1(HTT):c.1068+11A>G	NA	not provided	41334	Likely benign
4:3122935	NM_001388492.1(HTT):c.1069-20C>G	NA	not provided	46268	Uncertain significance
4:3122955	NM_001388492.1(HTT):c.1069G>T (p.Val357Phe)	NA	not provided	46288	Uncertain significance
4:3122969	NM_001388492.1(HTT):c.1083G>C (p.Thr361=)	NA	not provided	46302	Benign
4:3122989	NM_001388492.1(HTT):c.1103A>C (p.Gln368Pro)	NA	not provided	46322	Uncertain significance
4:3123010	NM_001388492.1(HTT):c.1124G>C (p.Gly375Ala)	NA	not provided	46343	Uncertain significance
4:3123043	NM_001388492.1(HTT):c.1157C>T (p.Thr386Met)	NA	not provided	46376	Uncertain significance
4:3123044	NM_001388492.1(HTT):c.1158G>A (p.Thr386=)	NA	not provided	46377	Likely benign
4:3123053	NM_001388492.1(HTT):c.1167C>T (p.Pro389=)	NA	not provided	46386	Likely benign
4:3123074	NM_001388492.1(HTT):c.1188C>T (p.Thr396=)	NA	not provided	46407	Benign
4:3123081	NM_001388492.1(HTT):c.1195G>A (p.Gly399Arg)	NA	not provided	46414	Uncertain significance
4:3123101	NM_001388492.1(HTT):c.1215C>G (p.Thr405=)	NA	not provided	46434	Likely benign
4:3123120	NM_001388492.1(HTT):c.1234G>C (p.Gly412Arg)	NA	not provided	46453	Uncertain significance
4:3123132	NM_001388492.1(HTT):c.1246C>T (p.Arg416Cys)	rs367833914	Inborn genetic diseases	46465	Uncertain significance
4:3123148	NM_001388492.1(HTT):c.1262T>C (p.Val421Ala)	NA	not provided	46481	Uncertain significance
4:3123167	NM_001388492.1(HTT):c.1273+8A>G	NA	not provided	46500	Likely benign
4:3123168	NM_001388492.1(HTT):c.1273+9T>C	NA	not provided	46501	Likely benign
4:3123175	NM_001388492.1(HTT):c.1273+16G>A	NA	not provided	46508	Likely benign
4:3124626	NM_001388492.1(HTT):c.1284T>C (p.Gly428=)	NA	not provided	47959	Likely benign
4:3124642	NM_001388492.1(HTT):c.1300G>A (p.Val434Ile)	NA	not provided	47975	Uncertain significance
4:3124676	NM_001388492.1(HTT):c.1321+13G>A	NA	not provided	48009	Benign
4:3124678	NM_001388492.1(HTT):c.1321+15A>T	NA	not provided	48011	Benign

Position	Population	BlockLength (kb)	Distance	Location with respect to STR	No. of SNPs	SNPs in the Haploblock
4:3029623-3029916	all_pop	0.294	-47044	downstream	2	rs7677445, rs279828,
4:3029916-3040068	EAS	10.153	-46751	downstream	27	rs2798282, rs3775065, rs373414764, rs12696706, rs7696040, rs2857842, rs2157097, rs1010290, rs732859, rs12506119, rs552690545, rs2857841, rs2857840, rs35163447, rs2798298, rs2857839, rs3832271, rs1008210, rs1557213, rs2187695, rs2067003, rs2187694, rs2071690, rs1801058, rs2071689, rs2071688, rs3402010,
4:3029916-3040587	EUR	10.672	-46751	downstream	28	rs2798282, rs3775065, rs373414764, rs12696706, rs7696040, rs2857842, rs2157097, rs1010290, rs732859, rs552690545, rs2857841, rs2857840, rs35163447, rs2798298, rs2857839, rs1008210, rs1557213, rs2187695, rs2067003, rs2187694, rs2071690, rs1801058, rs2071689, rs2071688, rs34020100, rs11451355, rs11462612, rs279830,
4:3030097-3038639	AMR	8.543	-46570	downstream	19	rs3775065, rs373414764, rs12696706, rs7696040, rs2857842, rs2157097, rs1010290, rs732859, rs12506119, rs552690545, rs2857841, rs2857840, rs35163447, rs2798298, rs2857839, rs1008210, rs1557213, rs2187695, rs206700,
4:3030180-3030522	AFR	0.343	-46487	downstream	5	rs73084155, rs112568993, rs113547389, rs373414764, rs11342926,
4:3030502-3031491	SAS	0.99	-46165	downstream	2	rs373414764, rs769604,
4:3030797-3031491	AFR	0.695	-45870	downstream	2	rs12696706, rs769604,
4:3030797-3032369	all_pop	1.573	-45870	downstream	3	rs12696706, rs7696040, rs285784,
4:3031688-3033643	AFR	1.956	-44979	downstream	6	rs2471329, rs2857842, rs2157097, rs2515931, rs1010290, rs73285,
4:3032369-3042610	SAS	10.242	-44298	downstream	24	rs2857842, rs2157097, rs1010290, rs732859, rs552690545, rs2857841, rs2857840, rs2798298, rs2857839, rs1008210, rs1557213, rs2187695, rs2067003, rs2187694, rs2071690, rs1801058, rs2071689, rs2071688, rs11451355, rs11462612, rs2798303, rs546497545, rs2798304, rs54855838,
4:3032528-3033643	all_pop	1.116	-44139	downstream	3	rs2157097, rs1010290, rs73285,
4:3034045-3034852	AFR	0.808	-42622	downstream	2	rs552690545, rs285784,
4:3034045-3034852	all_pop	0.808	-42622	downstream	2	rs552690545, rs285784,
4:3034958-3035068	AFR	0.111	-41709	downstream	2	rs2857840, rs3516344,
4:3034958-3035068	all_pop	0.111	-41709	downstream	2	rs2857840, rs3516344,
4:3035300-3035631	AFR	0.332	-41367	downstream	2	rs55942209, rs1194725,
4:3035300-3038713	all_pop	3.414	-41367	downstream	9	rs55942209, rs2798298, rs2857839, rs2995802, rs1008210, rs1557213, rs2187695, rs2067003, rs218769,
4:3036602-3038415	AFR	1.814	-40065	downstream	6	rs2798298, rs7679456, rs2857839, rs2995802, rs1008210, rs155721,
4:3038551-3038713	AFR	0.163	-38116	downstream	3	rs2187695, rs2067003, rs218769,
4:3038713-3038810	AMR	0.098	-37954	downstream	2	rs2187694, rs207169,
4:3039150-3040587	AFR	1.438	-37517	downstream	8	rs1801058, rs2071689, rs2071688, rs3021124, rs34020100, rs11451355, rs11462612, rs279830,
4:3039150-3040587	all_pop	1.438	-37517	downstream	8	rs1801058, rs2071689, rs2071688, rs3021124, rs34020100, rs11451355, rs11462612, rs279830,
4:3039150-3040587	AMR	1.438	-37517	downstream	7	rs1801058, rs2071689, rs2071688, rs34020100, rs11451355, rs11462612, rs279830,
4:3040573-3063817	EAS	23.245	-36094	downstream	55	rs11462612, rs2798303, rs546497545, rs2798304, rs548558381, rs140578392, rs34948788, rs2857854, rs2857853, rs2471342, rs2857852, rs2857851, rs2857850, rs2857849, rs2471347, rs34157939, rs34945363, rs3021126, rs2211474, rs35875899, rs2798285, rs2798286, rs11929936, rs2857847, rs2798289, rs2857846, rs2857843, rs34342095, rs1263308, rs13144633, rs34053308, rs1263309, rs1313766, rs1313767, rs1313768, rs10021325, rs61407336, rs1313769, rs35342954, rs1313770, rs1313771, rs1313772, rs33928111, rs141534383, rs1313773, rs1313774, rs2471334, rs57201001, rs13141939, rs7662820, rs2798296, rs2857936, rs373862551, rs61114397, rs769468,
4:3041425-3041938	AFR	0.514	-35242	downstream	3	rs546497545, rs10010375, rs279830,
4:3041425-3041938	all_pop	0.514	-35242	downstream	3	rs546497545, rs10010375, rs279830,
4:3041425-3041938	AMR	0.514	-35242	downstream	2	rs546497545, rs279830,
4:3041425-3041938	EUR	0.514	-35242	downstream	2	rs546497545, rs279830,
4:3042902-3043184	all_pop	0.283	-33765	downstream	4	rs2471343, rs34948788, rs2515934, rs285785,
4:3043079-3043468	AMR	0.39	-33588	downstream	5	rs34948788, rs2857854, rs2857853, rs2471342, rs285785,
4:3043079-3043468	EUR	0.39	-33588	downstream	5	rs34948788, rs2857854, rs2857853, rs2471342, rs285785,
4:3043079-3043420	SAS	0.342	-33588	downstream	4	rs34948788, rs2857854, rs2857853, rs247134,
4:3043134-3043184	AFR	0.051	-33533	downstream	2	rs2515934, rs285785,
4:3043420-3046853	AFR	3.434	-33247	downstream	17	rs2471342, rs2857852, rs2857851, rs2857850, rs2857849, rs2471347, rs34157939, rs34945363, rs3021126, rs2211474, rs79081069, rs116008596, rs35875899, rs2798285, rs2798286, rs11929936, rs285784,
4:3043468-3055477	all_pop	12.01	-33199	downstream	29	rs2857852, rs2857851, rs2857850, rs2857849, rs2471347, rs34157939, rs34945363, rs3021126, rs2211474, rs35875899, rs2798285, rs2798286, rs11929936, rs2857847, rs2798289, rs2857846, rs2857843, rs34342095, rs2515956, rs2471348, rs1263308, rs13144633, rs34053308, rs1263309, rs1313766, rs1313767, rs1313768, rs2488811, rs2879568,
4:3043468-3044435	SAS	0.968	-33199	downstream	5	rs2857852, rs2857851, rs2857850, rs2857849, rs247134,
4:3043512-3043513	AMR	0.002	-33155	downstream	2	rs2857851, rs285785,
4:3043512-3043513	EUR	0.002	-33155	downstream	2	rs2857851, rs285785,
4:3043638-3063411	AMR	19.774	-33029	downstream	43	rs2857849, rs2471347, rs34157939, rs34945363, rs3021126, rs2211474, rs35875899, rs2798285, rs2798286, rs11929936, rs2857847, rs2798289, rs2857846, rs2857843, rs34342095, rs1263308, rs13144633, rs34053308, rs1263309, rs1313766, rs1313767, rs1313768, rs28806864, rs10021325, rs61407336, rs184170941, rs1313769, rs35342954, rs1313770, rs1313771, rs1313772, rs33928111, rs141534383, rs1313773, rs1313774, rs2471334, rs1313775, rs57201001, rs13141939, rs7662820, rs2798296, rs2857936, rs37386255,
4:3043638-3063411	EUR	19.774	-33029	downstream	42	rs2857849, rs2471347, rs34157939, rs34945363, rs3021126, rs2211474, rs35875899, rs2798285, rs2798286, rs11929936, rs2857847, rs2798289, rs2857846, rs2857843, rs34342095, rs1263308, rs13144633, rs34053308, rs1263309, rs1313766, rs1313767, rs1313768, rs28806864, rs10021325, rs61407336, rs1313769, rs35342954, rs1313770, rs1313771, rs1313772, rs33928111, rs141534383, rs1313773, rs1313774, rs2471334, rs1313775, rs57201001, rs13141939, rs7662820, rs2798296, rs2857936, rs37386255,
4:3044530-3062310	SAS	17.781	-32137	downstream	29	rs3021126, rs2211474, rs2798285, rs2798286, rs2857847, rs2798289, rs2857846, rs2857843, rs1263308, rs1263309, rs1313766, rs1313767, rs1313768, rs532046886, rs1313769, rs61791250, rs1313770, rs1313771, rs1313772, rs33928111, rs1313773, rs1313774, rs2471334, rs1313775, rs57201001, rs7662820, rs61791251, rs2798296, rs285793,
4:3047537-3055477	AFR	7.941	-29130	downstream	26	rs2798289, rs2857846, rs2857843, rs182169526, rs55955897, rs56229383, rs34342095, rs141044134, rs2515956, rs61321259, rs61120626, rs2471348, rs56117041, rs1263308, rs113281116, rs13144633, rs199759766, rs34053308, rs1263309, rs144261209, rs1313766, rs1313767, rs2488810, rs111543532, rs2488811, rs2879568,
4:3055481-3055688	AFR	0.208	-21186	downstream	2	rs28806864, rs1002132,
4:3055688-3055956	all_pop	0.269	-20979	downstream	2	rs10021325, rs6140733,
4:3055956-3059394	AFR	3.439	-20711	downstream	19	rs61407336, rs112235951, rs138587288, rs1313769, rs61269488, rs6853929, rs6815398, rs35342954, rs1313770, rs1313771, rs1313772, rs33928111, rs74990177, rs77245839, rs141534383, rs28856696, rs6848638, rs2960299, rs682451,
4:3056437-3056975	all_pop	0.539	-20230	downstream	2	rs112235951, rs131376,
4:3057559-3057809	all_pop	0.251	-19108	downstream	2	rs35342954, rs131377,
4:3058583-3060263	all_pop	1.681	-18084	downstream	9	rs1313772, rs33928111, rs141534383, rs28856696, rs2960299, rs1313773, rs1313774, rs2471334, rs131377,
4:3060049-3060263	AFR	0.215	-16618	downstream	2	rs2471334, rs131377,
4:3060447-3063270	AFR	2.824	-16220	downstream	14	rs57201001, rs112954907, rs73086111, rs13141939, rs7662820, rs73086113, rs2798296, rs2857936, rs61293276, rs2471331, rs2471332, rs2471333, rs2960300, rs296030,
4:3060447-3062310	all_pop	1.864	-16220	downstream	6	rs57201001, rs73086111, rs13141939, rs7662820, rs2798296, rs285793,
4:3062772-3063270	all_pop	0.499	-13895	downstream	5	rs2471331, rs2471332, rs2471333, rs2960300, rs296030,
4:3063411-3063479	AFR	0.069	-13256	downstream	2	rs373862551, rs14604527,
4:3063411-3063739	all_pop	0.329	-13256	downstream	2	rs373862551, rs6111439,
4:3063411-3063817	SAS	0.407	-13256	downstream	3	rs373862551, rs61114397, rs769468,
4:3063737-3063739	AFR	0.003	-12930	downstream	2	rs547008964, rs6111439,
4:3063739-3063817	AMR	0.079	-12928	downstream	2	rs61114397, rs769468,
4:3063739-3064004	EUR	0.266	-12928	downstream	3	rs61114397, rs7694687, rs279829,
4:3063785-3063817	AFR	0.033	-12882	downstream	2	rs73086116, rs769468,
4:3064004-3064053	AFR	0.05	-12663	downstream	2	rs2798297, rs1250620,
4:3064004-3064053	all_pop	0.05	-12663	downstream	2	rs2798297, rs1250620,
4:3064004-3064053	AMR	0.05	-12663	downstream	2	rs2798297, rs1250620,
4:3064004-3064053	EAS	0.05	-12663	downstream	2	rs2798297, rs1250620,
4:3064004-3076339	SAS	12.336	-12663	downstream	42	rs2798297, rs12506200, rs16843779, rs61791252, rs368155721, rs61791253, rs7688282, rs145707119, rs9291159, rs61791254, rs61791255, rs16843127, rs77760116, rs57301890, rs9993542, rs563024282, rs7674896, rs113587927, rs147272122, rs139171719, rs112906962, rs76902612, rs61791257, rs61791258, rs73086139, rs73086140, rs113541600, rs61791259, rs61792460, rs73086144, rs73086145, rs61792461, rs61792462, rs61090955, rs77384845, rs10011412, rs61792464, rs111670395, rs762855, rs143861513, rs28431418, rs55863016,
4:3064759-3066932	AFR	2.174	-11908	downstream	9	rs61791252, rs368155721, rs2471353, rs61791253, rs7688282, rs145707119, rs75992088, rs7679861, rs929115,
4:3064759-3068545	all_pop	3.787	-11908	downstream	12	rs61791252, rs368155721, rs61791253, rs7688282, rs145707119, rs9291159, rs61791254, rs61791255, rs16843127, rs77760116, rs57301890, rs999354,
4:3066601-3066932	AMR	0.332	-10066	downstream	2	rs145707119, rs929115,
4:3066601-3073254	EUR	6.654	-10066	downstream	5	rs145707119, rs9291159, rs9993542, rs113541600, rs1001141,
4:3067074-3068062	AFR	0.989	-9593	downstream	7	rs61791254, rs61791255, rs112861063, rs80093929, rs16843127, rs77760116, rs5730189,
4:3068062-3068545	AMR	0.484	-8605	downstream	2	rs57301890, rs999354,
4:3068482-3071033	AFR	2.552	-8185	downstream	19	rs75683224, rs9993542, rs181260325, rs28718346, rs28584232, rs28394705, rs141794700, rs190712051, rs546197614, rs112121710, rs77099632, rs563024282, rs28629394, rs28714390, rs377090138, rs76326763, rs28682489, rs28398130, rs767489,
4:3069807-3070169	all_pop	0.363	-6860	downstream	6	rs28718346, rs28584232, rs28394705, rs141794700, rs190712051, rs7709963,
4:3070834-3070980	all_pop	0.147	-5833	downstream	5	rs28629394, rs28714390, rs377090138, rs28682489, rs2839813,
4:3071033-3071269	all_pop	0.237	-5634	downstream	8	rs7674896, rs113587927, rs147272122, rs139171719, rs112906962, rs76902612, rs61791257, rs6179125,
4:3071055-3071847	AFR	0.793	-5612	downstream	10	rs113587927, rs147272122, rs139171719, rs112906962, rs76902612, rs61791257, rs61791258, rs35631490, rs73086139, rs7308614,
4:3071802-3071847	all_pop	0.046	-4865	downstream	2	rs73086139, rs7308614,
4:3072231-3073087	AFR	0.857	-4436	downstream	7	rs61792460, rs73086144, rs73086145, rs61792461, rs61792462, rs74444018, rs11366139,
4:3072231-3072399	all_pop	0.169	-4436	downstream	4	rs61792460, rs73086144, rs73086145, rs6179246,
4:3072441-3073163	all_pop	0.723	-4226	downstream	2	rs61792462, rs6109095,
4:3073253-3073254	AFR	0.002	-3414	downstream	2	rs77384845, rs1001141,
4:3073253-3073254	all_pop	0.002	-3414	downstream	2	rs77384845, rs1001141,
4:3073385-3074993	AFR	1.609	-3282	downstream	9	rs61792464, rs116010556, rs79116692, rs112435590, rs61101785, rs111670395, rs762855, rs9996199, rs11558311,
4:3074473-3074795	all_pop	0.323	-2194	downstream	2	rs111670395, rs76285,
4:3074795-3074965	AMR	0.171	-1872	downstream	2	rs762855, rs999619,
4:3074795-3074965	EUR	0.171	-1872	downstream	2	rs762855, rs999619,
4:3074965-3076603	EAS	1.639	-1702	downstream	5	rs9996199, rs13122415, rs13132932, rs13102260, rs37407698,
4:3075312-3075736	AFR	0.425	-1355	downstream	5	rs114562181, rs143861513, rs115117610, rs28431418, rs2861683,
4:3075394-3075588	all_pop	0.195	-1273	downstream	2	rs143861513, rs2843141,
4:3075736-3076028	all_pop	0.293	-931	downstream	2	rs28616835, rs14962452,
4:3076028-3076121	AFR	0.094	-639	downstream	2	rs149624523, rs11619154,
4:3076181-3076603	AMR	0.423	-486	downstream	4	rs13122415, rs13132932, rs13102260, rs37407698,
4:3076266-3076405	AFR	0.14	-401	downstream	2	rs13132932, rs1310226,
4:3076405-3077594	all_pop	1.19	-262	downstream	5	rs13102260, rs374076986, rs547233813, rs10009935, rs5887077,
4:3077037-3079595	AFR	2.559	370	upstream	13	rs10009935, rs559254666, rs58870770, rs34045730, rs28656215, rs28571971, rs28583447, rs28468636, rs28564368, rs28485764, rs77173925, rs3905238, rs3395043,
4:3077985-3079595	all_pop	1.611	1318	upstream	9	rs28656215, rs28571971, rs28583447, rs28468636, rs28564368, rs28485764, rs77173925, rs3905238, rs3395043,
4:3077985-3085261	EAS	7.277	1318	upstream	7	rs28656215, rs3905238, rs3856973, rs4498089, rs57666989, rs61792473, rs6179247,
4:3078937-3080199	EUR	1.263	2270	upstream	3	rs3905238, rs3856973, rs449808,
4:3078937-3080173	SAS	1.237	2270	upstream	2	rs3905238, rs385697,
4:3080173-3080199	AMR	0.027	3506	upstream	2	rs3856973, rs449808,
4:3080199-3085261	AFR	5.063	3532	upstream	22	rs4498089, rs112527131, rs112353753, rs138997144, rs10006129, rs146168738, rs28696693, rs28393280, rs6835897, rs6836289, rs6836533, rs7436457, rs7442144, rs4499655, rs4346595, rs61792472, rs145067355, rs6830019, rs7664480, rs73088115, rs61792473, rs6179247,
4:3080199-3082423	all_pop	2.225	3532	upstream	9	rs4498089, rs112353753, rs57666989, rs10006129, rs28696693, rs28393280, rs6835897, rs7436457, rs434659,
4:3080562-3085261	AMR	4.7	3895	upstream	3	rs57666989, rs61792473, rs6179247,
4:3080562-3085477	EUR	4.916	3895	upstream	6	rs57666989, rs61792473, rs61792474, rs112418837, rs61792477, rs2886743,
4:3082861-3083762	all_pop	0.902	6194	upstream	2	rs61792472, rs14506735,
4:3082861-3104351	SAS	21.491	6194	upstream	25	rs61792472, rs145067355, rs61792473, rs61792474, rs540965650, rs112418837, rs61792477, rs28867436, rs4690071, rs2285087, rs2285086, rs61348208, rs28595292, rs59147561, rs56794194, rs61460614, rs28820097, rs28834148, rs7659144, rs7688390, rs113694220, rs34591077, rs61792500, rs61792501, rs1684380,
4:3083883-3085261	all_pop	1.379	7216	upstream	4	rs6830019, rs7664480, rs61792473, rs6179247,
4:3085293-3085477	all_pop	0.185	8626	upstream	3	rs112418837, rs61792477, rs2886743,
4:3085293-3085427	AMR	0.135	8626	upstream	2	rs112418837, rs6179247,
4:3085427-3086597	AFR	1.171	8760	upstream	5	rs61792477, rs28867436, rs77117483, rs114377182, rs11181127,
4:3085477-3091714	AMR	6.238	8810	upstream	7	rs28867436, rs4690071, rs58666167, rs2285087, rs2285086, rs61348208, rs5979712,
4:3085477-3152973	EAS	67.497	8810	upstream	47	rs28867436, rs4690071, rs2285087, rs2285086, rs61348208, rs75000150, rs34179563, rs28820097, rs7659144, rs16843804, rs2024115, rs73191188, rs3733217, rs10015979, rs113294358, rs79021362, rs199585288, rs11430179, rs6446722, rs7691627, rs55962025, rs16843836, rs10488839, rs17780797, rs2071655, rs16843856, rs4690072, rs6446723, rs537145951, rs201785861, rs363066, rs11409456, rs570335692, rs59613878, rs143164160, rs1891701, rs363064, rs363063, rs363072, rs61792530, rs12499033, rs12502045, rs6855981, rs11731237, rs13122237, rs67950027, rs3408464,
4:3086745-3086753	AFR	0.009	10078	upstream	2	rs551509828, rs469007,
4:3086753-3091714	all_pop	4.962	10086	upstream	6	rs4690071, rs58666167, rs2285087, rs2285086, rs61348208, rs5979712,
4:3086753-3089564	EUR	2.812	10086	upstream	4	rs4690071, rs2285087, rs2285086, rs6134820,
4:3087142-3104255	AFR	17.114	10475	upstream	40	rs58666167, rs2285087, rs73088118, rs57875258, rs2285086, rs74890150, rs61348208, rs113467868, rs113933019, rs76442945, rs139401618, rs56742332, rs59797128, rs28595292, rs73088123, rs57792935, rs9996075, rs2798236, rs75468757, rs56148664, rs112661558, rs7669483, rs539002350, rs541406012, rs113359490, rs186403576, rs113548858, rs59147561, rs56794194, rs61460614, rs28820097, rs28834148, rs7659144, rs7688390, rs113694220, rs28580164, rs34591077, rs61792500, rs116260986, rs6179250,
4:3091761-3097654	EUR	5.894	15094	upstream	4	rs28595292, rs59147561, rs28820097, rs2883414,
4:3094342-3096371	all_pop	2.03	17675	upstream	3	rs112661558, rs75000150, rs53900235,
4:3094342-3096925	AMR	2.584	17675	upstream	5	rs112661558, rs34179563, rs539002350, rs186403576, rs5914756,
4:3096925-3097654	all_pop	0.73	20258	upstream	5	rs59147561, rs56794194, rs61460614, rs28820097, rs2883414,
4:3097495-3098321	AMR	0.827	20828	upstream	3	rs28820097, rs28834148, rs765914,
4:3098889-3102689	all_pop	3.801	22222	upstream	2	rs7688390, rs11369422,
4:3098889-3104390	EUR	5.502	22222	upstream	2	rs7688390, rs1684380,
4:3102982-3104255	all_pop	1.274	26315	upstream	3	rs34591077, rs61792500, rs6179250,
4:3104390-3105811	all_pop	1.422	27723	upstream	4	rs16843804, rs2024115, rs73191188, rs11239111,
4:3104390-3113337	SAS	8.948	27723	upstream	21	rs16843804, rs2024115, rs73191188, rs7665816, rs145027973, rs10015979, rs16843824, rs17780617, rs113294358, rs79021362, rs199585288, rs11430179, rs6446722, rs7686771, rs7691627, rs61792502, rs61792503, rs55962025, rs10012793, rs6828615, rs1684383,
4:3104568-3104756	AFR	0.189	27901	upstream	2	rs2024115, rs7611548,
4:3104568-3105811	AMR	1.244	27901	upstream	3	rs2024115, rs73191188, rs11239111,
4:3104568-3105200	EUR	0.633	27901	upstream	2	rs2024115, rs7319118,
4:3105200-3110226	AFR	5.027	28533	upstream	13	rs73191188, rs73088132, rs112391116, rs113739392, rs7665816, rs7693317, rs10015979, rs16843824, rs143281159, rs530407659, rs540732339, rs532609285, rs1001675,
4:3107604-3109442	all_pop	1.839	30937	upstream	3	rs7665816, rs7693317, rs1001597,
4:3107604-3109442	EUR	1.839	30937	upstream	2	rs7665816, rs1001597,
4:3109442-3111103	AMR	1.662	32775	upstream	6	rs10015979, rs113294358, rs79021362, rs199585288, rs11430179, rs644672,
4:3110794-3111103	AFR	0.31	34127	upstream	5	rs113294358, rs79021362, rs199585288, rs11430179, rs644672,
4:3110794-3111103	all_pop	0.31	34127	upstream	5	rs113294358, rs79021362, rs199585288, rs11430179, rs644672,
4:3110794-3111103	EUR	0.31	34127	upstream	5	rs113294358, rs79021362, rs199585288, rs11430179, rs644672,
4:3111232-3133785	AFR	22.554	34565	upstream	60	rs7686771, rs112922031, rs7691627, rs61792502, rs61792503, rs113383105, rs55962025, rs113118385, rs10012793, rs6828615, rs6843895, rs6834455, rs57833463, rs10002065, rs28652828, rs28660254, rs61792505, rs202217324, rs7440822, rs1419036, rs1936032, rs17780797, rs2071655, rs16843856, rs16843857, rs7663133, rs16843866, rs75523315, rs75065354, rs16843869, rs61583241, rs28634516, rs4690072, rs1065745, rs73088147, rs61792507, rs73792195, rs60340572, rs28583552, rs56021098, rs73088150, rs6446723, rs58673147, rs61792508, rs115120497, rs16843871, rs61792509, rs113454410, rs7682324, rs363070, rs363087, rs363085, rs363084, rs363082, rs80256013, rs363069, rs363068, rs363067, rs3025853, rs302585,
4:3111410-3112109	all_pop	0.7	34743	upstream	4	rs7691627, rs61792502, rs61792503, rs5596202,
4:3111410-3112109	AMR	0.7	34743	upstream	2	rs7691627, rs5596202,
4:3111410-3112109	EUR	0.7	34743	upstream	2	rs7691627, rs5596202,
4:3113025-3115577	all_pop	2.553	36358	upstream	9	rs10012793, rs6828615, rs16843836, rs6843895, rs6834455, rs10002065, rs2798235, rs28652828, rs2866025,
4:3113025-3126813	AMR	13.789	36358	upstream	14	rs10012793, rs6828615, rs16843836, rs6843895, rs6834455, rs2798235, rs17780797, rs2071655, rs16843856, rs79917137, rs7663133, rs116257298, rs4690072, rs644672,
4:3113025-3113188	EUR	0.164	36358	upstream	2	rs10012793, rs682861,
4:3113337-3133911	EUR	20.575	36670	upstream	10	rs16843836, rs6843895, rs6834455, rs2798235, rs17780797, rs2071655, rs7663133, rs4690072, rs6446723, rs36308,
4:3113569-3113648	SAS	0.08	36902	upstream	2	rs6843895, rs683445,
4:3116283-3157481	SAS	41.199	39616	upstream	78	rs61792505, rs17780797, rs2071655, rs7663133, rs61583241, rs4690072, rs1065745, rs61792507, rs6446723, rs61792508, rs61792509, rs7682324, rs363070, rs363087, rs363084, rs363082, rs363069, rs363068, rs363067, rs363080, rs363078, rs537145951, rs61792510, rs201785861, rs363066, rs533276449, rs11409456, rs11311818, rs363065, rs570335692, rs61792512, rs6829069, rs544832537, rs61792513, rs59613878, rs143164160, rs77508797, rs75869660, rs61792515, rs1891701, rs363064, rs363063, rs143579322, rs363074, rs7692292, rs3025851, rs363072, rs72239206, rs3025849, rs363071, rs363107, rs201187901, rs57196404, rs61792530, rs61792531, rs363106, rs363105, rs363104, rs12499033, rs12502045, rs363103, rs6855981, rs113304256, rs61792532, rs73073018, rs111798140, rs141404245, rs61792533, rs11731237, rs13122237, rs67950027, rs34084646, rs553915801, rs60197694, rs10155264, rs363101, rs61792535, rs11275719,
4:3116847-3121144	all_pop	4.298	40180	upstream	8	rs1419036, rs17780797, rs2071655, rs16843856, rs16843857, rs7663133, rs16843866, rs1684386,
4:3122507-3123860	all_pop	1.354	45840	upstream	3	rs4690072, rs1065745, rs6179250,
4:3125050-3126813	all_pop	1.764	48383	upstream	2	rs28583552, rs644672,

Conservation score was not calculated