STRIDE-DB

Repeat Length	AFR	AMR	EUR	EAS	SAS	Repeat
2.7	2	0	0	0	4	GCGGCGGC
14.7	413	128	240	196	378	GCGGCGGCGGCGGCTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC
3.7	1	0	0	0	0	GCGGCGGCGGC
4.7	0	0	0	1	0	GCGGCGGCGGCGGC
8.7	6	19	42	6	6	GCGGCGGCGGCGGCTGCGGCGGCGGC
12.7	0	0	2	0	1	GCGGCGGCGGCGGCTGCGGCGGCGGCGGCGGCTGCGGC
13.7	10	3	2	5	7	GCGGCGGCGGCGGCTGCGGCGGCGGCGGCGGCTGCGGCGGC

Position	Disease/Trait	P-value	SNPs	Location with respect to STR	distance	Study
6:45342051	Nose morphology,	4.0E-8	rs12208924	downstream	-48437	A genome-wide association study of facial morphology identifies novel genetic loci in Han Chinese.
6:45357699	Osteoarthritis (hip),	2.0E-12	rs2396502	downstream	-32789	Identification of new therapeutic targets for osteoarthritis through genome-wide analyses of UK Biobank data.
6:45358107	OTU97 16 (Faecalibacterium) prevalence,	7.0E-7	rs6908650	downstream	-32381	Genome-wide association study in 8,956 German individuals identifies influence of ABO histo-blood groups on gut microbiome.
6:45374183	Osteoarthritis (hip),	1.0E-11	rs1997995	downstream	-16305	Meta-analysis of Icelandic and UK data sets identifies missense variants in SMO, IL11, COL11A1 and 13 more new loci associated with osteoarthritis.
6:45376221	Hip minimal joint space width,	1.0E-9	rs12206662	downstream	-14267	Novel Genetic Variants for Cartilage Thickness and Hip Osteoarthritis.
6:45384018	Osteoarthritis (with total hip replacement),	9.0E-13	rs17288390	downstream	-6470	Deciphering osteoarthritis genetics across 826,690 individuals from 9 populations.
6:45395789	White matter microstructure (radial diusivities),	3.0E-8	rs2819860	upstream	5301	Large-scale GWAS reveals genetic architecture of brain white matter microstructure and genetic overlap with cognitive and mental health traits (n = 17,706).
6:45397050	White matter microstructure (mean diusivities),	1.0E-8	rs2677102	upstream	6562	Large-scale GWAS reveals genetic architecture of brain white matter microstructure and genetic overlap with cognitive and mental health traits (n = 17,706).
6:45397050	White matter microstructure (radial diusivities),	6.0E-10	rs2677102	upstream	6562	Large-scale GWAS reveals genetic architecture of brain white matter microstructure and genetic overlap with cognitive and mental health traits (n = 17,706).
6:45403774	Height,	3.0E-11	rs2677108	upstream	13286	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
6:45407654	aseg lh intensity Putamen,	1.0E-21	rs2677109	upstream	17166	An expanded set of genome-wide association studies of brain imaging phenotypes in UK Biobank.
6:45407654	aseg rh intensity Putamen,	8.0E-22	rs2677109	upstream	17166	An expanded set of genome-wide association studies of brain imaging phenotypes in UK Biobank.
6:45408440	Hip shape (DXA scan),	7.0E-9	rs6458443	upstream	17952	Identification of novel loci associated with hip shape: a meta-analysis of genome-wide association studies.
6:45410312	Cortical thickness (min-P),	7.0E-9	rs910586	upstream	19824	Understanding the genetic determinants of the brain with MOSTest.
6:45410312	Brain morphology (min-P),	2.0E-8	rs910586	upstream	19824	Understanding the genetic determinants of the brain with MOSTest.
6:45410312	aseg lh volume CerebralWhiteMatter,	3.0E-9	rs910586	upstream	19824	An expanded set of genome-wide association studies of brain imaging phenotypes in UK Biobank.
6:45410312	aseg rh intensity Thalamus-Proper,	2.0E-15	rs910586	upstream	19824	An expanded set of genome-wide association studies of brain imaging phenotypes in UK Biobank.
6:45419110	aseg lh intensity Thalamus-Proper,	6.0E-14	rs2820339	upstream	28622	An expanded set of genome-wide association studies of brain imaging phenotypes in UK Biobank.
6:45422199	Eosinophil counts,	4.0E-9	rs147081589	upstream	31711	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
6:45422199	Eosinophil percentage of white cells,	2.0E-9	rs147081589	upstream	31711	The Polygenic and Monogenic Basis of Blood Traits and Diseases.
6:45424940	Cortical thickness (MOSTest),	2.0E-9	rs2819861	upstream	34452	Understanding the genetic determinants of the brain with MOSTest.
6:45424940	Brain region volumes,	3.0E-11	rs2819861	upstream	34452	Genome-wide association analysis of 19,629 individuals identifies variants influencing regional brain volumes and refines their genetic co-architecture with cognitive and mental health traits.
6:45424940	Brain region volumes,	2.0E-8	rs2819861	upstream	34452	Genome-wide association analysis of 19,629 individuals identifies variants influencing regional brain volumes and refines their genetic co-architecture with cognitive and mental health traits.
6:45424940	Brain region volumes,	1.0E-8	rs2819861	upstream	34452	Genome-wide association analysis of 19,629 individuals identifies variants influencing regional brain volumes and refines their genetic co-architecture with cognitive and mental health traits.
6:45428509	Brain region volumes,	3.0E-9	rs35405209	upstream	38021	Genome-wide association analysis of 19,629 individuals identifies variants influencing regional brain volumes and refines their genetic co-architecture with cognitive and mental health traits.
6:45432214	Subcortical volume (MOSTest),	4.0E-12	rs2790102	upstream	41726	Understanding the genetic determinants of the brain with MOSTest.
6:45432265	Brain morphology (MOSTest),	5.0E-16	rs2790103	upstream	41777	Understanding the genetic determinants of the brain with MOSTest.

Flanking region : 5 kb 10 kb 50 kb

Position	HGVS	dbSNP id	Phenotype List	Distance	Clinvar Significance
6:45341183	NC_000006.11:g.45308920_45413885dup	NA	Metaphyseal dysplasia-maxillary hypoplasia-brachydacty syndrome	-49305	Pathogenic
6:45352106	GRCh37/hg19 6p21.1(chr6:45352106-45382450)x1	NA	not provided	-38382	Uncertain significance
6:45389289	NM_001024630.4(RUNX2):c.59-1041T>C	NA	not provided	-1199	Benign
6:45389658	NM_001024630.4(RUNX2):c.59-672T>A	NA	not provided	-830	Benign
6:45389841	NM_001024630.4(RUNX2):c.59-489G>A	NA	not provided	-647	Likely benign
6:45390088	NM_001024630.4(RUNX2):c.59-242G>T	NA	not provided	-400	Likely benign
6:45390324	NM_001024630.4(RUNX2):c.59-6C>T	NA	not provided	-164	Uncertain significance
6:45390345	NM_001024630.4(RUNX2):c.74G>A (p.Arg25Gln)	NA	not provided	-143	Uncertain significance
6:45390348	NM_001024630.4(RUNX2):c.77G>C (p.Arg26Pro)	NA	not provided	-140	Uncertain significance
6:45390354	NM_001024630.4(RUNX2):c.90dup (p.Ser31fs)	rs397515538	Cleidocranial dysostosis	-134	not provided
6:45390354	NM_001024630.4(RUNX2):c.90dup (p.Ser31fs)	rs397515538	Cleidocranial dysostosis	-134	not provided
6:45390355	NM_001024630.4(RUNX2):c.90del (p.Ser31fs)	rs397515538	Cleidocranial dysostosis	-133	Likely pathogenic
6:45390359	NM_001024630.4(RUNX2):c.88C>G (p.Pro30Ala)	NA	not provided	-129	Uncertain significance
6:45390380	NM_001024630.4(RUNX2):c.109G>T (p.Gly37Cys)	NA	not provided	-108	Uncertain significance
6:45390395	NM_001024630.4(RUNX2):c.124G>T (p.Val42Leu)	rs753332305	Cleidocranial dysostosis	-93	Benign
6:45390408	NM_001024630.4(RUNX2):c.138_175dup (p.Gln59fs)	NA	not provided	-80	Pathogenic
6:45390414	NM_001024630.4(RUNX2):c.159_185dup (p.Gln63_Gln71dup)	NA	not provided	-74	Uncertain significance
6:45390415	NM_001024630.4(RUNX2):c.159_185del (p.Gln63_Gln71del)	rs747537373	not specified	-73	Likely benign
6:45390415	NM_001024630.4(RUNX2):c.147ACAGCAGCAGCA[1] (p.Gln68_Gln71del)	NA	not provided	-73	Uncertain significance
6:45390418	NM_001024630.4(RUNX2):c.159ACAGCAGCAGCAGCA[3] (p.Gln67_Gln71dup)	rs781355841	Cleidocranial dysostosis\|not provided	-70	Uncertain significance
6:45390419	NM_001024630.4(RUNX2):c.159ACAGCAGCAGCAGCA[1] (p.Gln67_Gln71del)	rs781355841	not provided	-69	Uncertain significance
6:45390422	NM_001024630.4(RUNX2):c.151C>A (p.Gln51Lys)	rs368475300	not specified	-66	Likely benign
6:45390430	NM_001024630.4(RUNX2):c.172CAACAGCAGCAGCAGCAGCAG[3] (p.Gln65_Gln71dup)	rs774172072	not provided	-58	Uncertain significance
6:45390431	NM_001024630.4(RUNX2):c.172CAACAGCAGCAGCAGCAGCAG[1] (p.Gln65_Gln71del)	rs774172072	not specified\|not provided	-57	Conflicting interpretations of pathogenicity
6:45390431	NM_001024630.4(RUNX2):c.172CAACAGCAGCAGCAGCAGCAG[1] (p.Gln65_Gln71del)	rs774172072	not specified\|not provided	-57	Conflicting interpretations of pathogenicity
6:45390433	NM_001024630.4(RUNX2):c.174_185dup (p.Gln68_Gln71dup)	NA	not provided	-55	Conflicting interpretations of pathogenicity
6:45390445	NM_001024630.4(RUNX2):c.177GCA[8] (p.Gln70_Gln71dup)	rs759395776	not provided	-43	Uncertain significance
6:45390445	NM_001024630.4(RUNX2):c.174A>G (p.Gln58=)	NA	not provided	-43	Likely benign
6:45390445	NM_001024630.4(RUNX2):c.177GCA[7] (p.Gln71dup)	NA	not provided	-43	Conflicting interpretations of pathogenicity
6:45390445	NM_001024630.4(RUNX2):c.177GCA[11] (p.Gln67_Gln71dup)	NA	not provided	-43	Uncertain significance
6:45390446	NM_001024630.4(RUNX2):c.190_213del (p.Gln64_Gln71del)	NA	not provided	-42	Uncertain significance
6:45390447	NM_001024630.4(RUNX2):c.176A>G (p.Gln59Arg)	rs779943223	Cleidocranial dysostosis\|not provided	-41	Conflicting interpretations of pathogenicity
6:45390448	NM_001024630.4(RUNX2):c.177G>A (p.Gln59=)	NA	not provided	-40	Likely benign
6:45390451	NM_001024630.4(RUNX2):c.195_209dup (p.Gln67_Gln71dup)	NA	not provided	-37	Uncertain significance
6:45390455	NM_001024630.4(RUNX2):c.184C>T (p.Gln62Ter)	NA	not provided	-33	Pathogenic
6:45390460	NM_001024630.4(RUNX2):c.189_203delinsACAGCAGCAGCAGCAGCAGCAACAGCAGCCG (p.Glu72fs)	rs730880313	Cleidocranial dysostosis	-28	Pathogenic
6:45390460	NM_001024630.4(RUNX2):c.189_203delinsACAGCAGCAGCAGCAGCAGCAACAGCAGCCG (p.Glu72fs)	rs730880313	Cleidocranial dysostosis	-28	Pathogenic
6:45390466	NM_001024630.4(RUNX2):c.195A>G (p.Gln65=)	NA	not provided\|not specified	-22	Likely benign
6:45390466	NM_001024630.4(RUNX2):c.196CAG[7] (p.Gln71dup)	NA	not provided	-22	Uncertain significance
6:45390470	NM_001024630.4(RUNX2):c.199_200del (p.Gln67fs)	rs1798243337	not provided	-18	Uncertain significance
6:45390471	NM_001024630.4(RUNX2):c.200_201insACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAACAGCAG (p.Glu72fs)	NA	not provided	-17	Pathogenic
6:45390472	NM_001024630.4(RUNX2):c.201G>A (p.Gln67=)	NA	not specified	-16	Likely benign
6:45390474	NM_001024630.4(RUNX2):c.203delinsCG (p.Gln68fs)	rs1798243790	Cleidocranial dysostosis	-14	Likely pathogenic
6:45390481	NM_001024630.4(RUNX2):c.210G>A (p.Gln70=)	NA	not provided	-7	Likely benign
6:45390482	NM_001024630.4(RUNX2):c.211C>T (p.Gln71Ter)	rs774631263	Cleidocranial dysostosis\|not provided	-6	Likely pathogenic
6:45390486	NM_001024630.4(RUNX2):c.216GGC[6] (p.Ala89dup)	rs746557318	not provided	-2	Uncertain significance
6:45390486	NM_001024630.4(RUNX2):c.225GGCGGCTGCGGCGGCGGC[3] (p.Ala84_Ala89dup)	NA	not provided	-2	Uncertain significance
6:45390486	NM_001024630.4(RUNX2):c.216GGC[7] (p.Ala88_Ala89dup)	NA	not provided	-2	Uncertain significance
6:45390487	NM_001024630.4(RUNX2):c.217del (p.Ala73fs)	rs1554384228	Cleidocranial dysostosis\|Metaphyseal dysplasia-maxillary hypoplasia-brachydacty syndrome	-1	Conflicting interpretations of pathogenicity
6:45390487	NM_001024630.4(RUNX2):c.228_260dup (p.Ala79_Ala89dup)	NA	not provided	-1	Uncertain significance
6:45390487	NM_001024630.4(RUNX2):c.228_248del (p.Ala83_Ala89del)	NA	not provided	-1	Uncertain significance
6:45390487	NM_001024630.4(RUNX2):c.216GGC[4] (p.Ala89del)	NA	not provided	-1	Uncertain significance
6:45390487	NM_001024630.4(RUNX2):c.216G>C (p.Glu72Asp)	NA	not provided	-1	Uncertain significance
6:45390490	NM_001024630.4(RUNX2):c.231_260dup (p.Ala80_Ala89dup)	rs606231174	Cleidocranial dysplasia, forme fruste, with brachydactyly	2	Pathogenic
6:45390490	NM_001024630.4(RUNX2):c.231_260dup (p.Ala80_Ala89dup)	rs606231174	Cleidocranial dysplasia, forme fruste, with brachydactyly	2	Pathogenic
6:45390490	NM_001024630.4(RUNX2):c.219G>T (p.Ala73=)	rs1022449962	not provided	2	Likely benign
6:45390490	NM_001024630.4(RUNX2):c.219G>A (p.Ala73=)	NA	not provided	2	Likely benign
6:45390492	NM_001024630.4(RUNX2):c.221C>A (p.Ala74Glu)	NA	not provided	4	Uncertain significance
6:45390493	NM_001024630.4(RUNX2):c.222G>C (p.Ala74=)	NA	not provided	5	Likely benign
6:45390493	NM_001024630.4(RUNX2):c.239_240insAGCGGCGGCTGCGGCGGC (p.Ala84_Ala89dup)	NA	not provided	5	Uncertain significance
6:45390493	NM_001024630.4(RUNX2):c.222G>A (p.Ala74=)	NA	not provided	5	Likely benign
6:45390496	NM_001024630.4(RUNX2):c.225G>A (p.Ala75=)	NA	not provided	8	Likely benign
6:45390497	NM_001024630.4(RUNX2):c.231_236del (p.Ala88_Ala89del)	NA	not provided	9	Uncertain significance
6:45390499	NM_001024630.4(RUNX2):c.228G>A (p.Ala76=)	NA	not provided	11	Likely benign
6:45390501	NM_001024630.4(RUNX2):c.230_231del (p.Ala77fs)	NA	not provided	13	Pathogenic
6:45390502	NM_001024630.4(RUNX2):c.234GGC[6] (p.Ala89dup)	NA	not provided	14	Uncertain significance
6:45390503	NM_001024630.4(RUNX2):c.234GGC[2] (p.Ala87_Ala89del)	NA	not provided	15	Uncertain significance
6:45390504	NM_001024630.4(RUNX2):c.233_234insAGGA (p.Ala79fs)	rs1338909353	Cleidocranial dysostosis\|Metaphyseal dysplasia-maxillary hypoplasia-brachydacty syndrome	16	Uncertain significance
6:45390505	NM_001024630.4(RUNX2):c.234G>A (p.Ala78=)	rs886061493	Cleidocranial dysostosis	17	Likely benign
6:45390505	NM_001024630.4(RUNX2):c.246_260dup (p.Ala85_Ala89dup)	NA	not provided	17	Uncertain significance
6:45390511	NM_001024630.4(RUNX2):c.240G>A (p.Ala80=)	rs6921145	not specified\|Cleidocranial dysostosis\|not provided	23	Benign
6:45390511	NM_001024630.4(RUNX2):c.240G>A (p.Ala80=)	rs6921145	not specified\|Cleidocranial dysostosis\|not provided	23	Benign
6:45390514	NM_001024630.4(RUNX2):c.225GGCGGCTGCGGCGGCGGC[1] (p.Ala84_Ala89del)	rs11498192	not specified\|not provided\|Cleidocranial dysostosis	26	Benign/Likely benign
6:45390514	NM_001024630.4(RUNX2):c.249_254dup (p.Ala88_Ala89dup)	NA	not provided	26	Uncertain significance
6:45390525	NM_001024630.4(RUNX2):c.254C>T (p.Ala85Val)	rs372138746	not provided\|not specified	37	Benign/Likely benign
6:45390541	NM_001024630.4(RUNX2):c.274dup (p.Arg92fs)	NA	not provided	53	Pathogenic
6:45390542	NM_001024630.4(RUNX2):c.274del (p.Arg92fs)	NA	not provided	54	Pathogenic
6:45390546	NM_001024630.4(RUNX2):c.275G>A (p.Arg92Gln)	rs772777645	not provided	58	Uncertain significance
6:45390547	NM_001024630.4(RUNX2):c.276G>A (p.Arg92=)	NA	not provided	59	Likely benign
6:45390549	NM_001024630.4(RUNX2):c.278T>A (p.Leu93Ter)	rs1798255831	not provided	61	Pathogenic
6:45390562	NM_001024630.4(RUNX2):c.291C>A (p.His97Gln)	NA	not provided	74	Uncertain significance
6:45390569	NM_001024630.4(RUNX2):c.298C>A (p.Arg100Ser)	rs754711247	Cleidocranial dysostosis	81	Uncertain significance
6:45390574	NM_001024630.4(RUNX2):c.303C>A (p.Thr101=)	NA	not provided	86	Likely benign
6:45390575	NM_001024630.4(RUNX2):c.304A>G (p.Met102Val)	rs376849024	not provided	87	Uncertain significance
6:45390598	NM_001024630.4(RUNX2):c.329del (p.Pro110fs)	rs1798259380	not provided	110	Pathogenic
6:45390607	NM_001024630.4(RUNX2):c.336A>G (p.Glu112=)	NA	not provided	119	Benign
6:45390611	NM_001024630.4(RUNX2):c.340G>A (p.Val114Ile)	NA	Craniosynostosis syndrome	123	Uncertain significance
6:45390639	NM_001024630.4(RUNX2):c.368G>A (p.Cys123Tyr)	rs1582095105	Cleidocranial dysostosis	151	Uncertain significance
6:45390642	NM_001024630.4(RUNX2):c.371C>A (p.Ser124Ter)	rs1582095109	Cleidocranial dysostosis	154	Pathogenic
6:45390642	NM_001024630.4(RUNX2):c.371C>G (p.Ser124Trp)	rs1582095109	not provided	154	Uncertain significance
6:45390648	NM_001024630.4(RUNX2):c.377T>A (p.Leu126Gln)	NA	not provided	160	Uncertain significance
6:45390651	NM_001024630.4(RUNX2):c.380C>G (p.Pro127Arg)	NA	not provided	163	Uncertain significance
6:45390659	NM_001024630.4(RUNX2):c.388T>C (p.Trp130Arg)	NA	not provided	171	Uncertain significance
6:45390675	NM_001024630.4(RUNX2):c.407_411del (p.Leu136fs)	NA	Cleidocranial dysostosis	187	Pathogenic
6:45390678	NM_001024630.4(RUNX2):c.407T>C (p.Leu136Pro)	NA	not provided	190	Pathogenic
6:45390682	NM_001024630.4(RUNX2):c.411C>A (p.Pro137=)	NA	not provided	194	Likely benign
6:45390691	NM_001024630.4(RUNX2):c.422dup (p.Val142fs)	NA	not provided	203	Pathogenic
6:45390692	NM_001024630.4(RUNX2):c.423+1_423+5del	NA	not provided	204	Pathogenic
6:45390696	NM_001024630.4(RUNX2):c.423+2del	rs1798262516	Cleidocranial dysostosis	208	Likely pathogenic
6:45390696	NM_001024630.4(RUNX2):c.423+2T>G	NA	not provided	208	Pathogenic
6:45390711	NM_001024630.4(RUNX2):c.423+17C>T	NA	not provided	223	Benign
6:45390712	NM_001024630.4(RUNX2):c.423+18C>T	NA	not provided	224	Likely benign
6:45390733	NM_001024630.4(RUNX2):c.423+39G>C	rs3749864	not specified\|not provided	245	Benign
6:45390838	NM_001024630.4(RUNX2):c.423+146_423+147dup	NA	not provided	350	Benign
6:45390949	NM_001024630.4(RUNX2):c.423+255G>C	NA	not provided	461	Benign
6:45390962	NM_001024630.4(RUNX2):c.423+268C>T	NA	not provided	474	Benign
6:45390973	NM_001024630.4(RUNX2):c.423+279C>T	NA	not provided	485	Likely benign
6:45392982	GRCh37/hg19 6p21.1(chr6:45392982-45402917)x3	NA	not provided	2494	Benign
6:45394329	GRCh37/hg19 6p21.1(chr6:45394329-45396544)x4	NA	not provided	3841	Benign
6:45399580	NC_000006.11:g.(?_45399580)_(45399776_?)del	NA	not provided	9092	Pathogenic
6:45399580	NC_000006.11:g.(?_45399580)_(45405808_?)del	NA	not provided	9092	Pathogenic
6:45399598	NM_001024630.4(RUNX2):c.424-2A>G	NA	not provided	9110	Likely pathogenic
6:45399619	NM_001024630.4(RUNX2):c.443_454delinsG (p.Val148fs)	rs1798551566	Cleidocranial dysostosis	9131	Pathogenic
6:45399635	NM_001024630.4(RUNX2):c.459G>A (p.Val153=)	NA	not provided	9147	Likely benign
6:45399652	NM_001024630.4(RUNX2):c.476G>A (p.Gly159Asp)	rs864621970	Cleidocranial dysostosis	9164	Pathogenic
6:45399652	NM_001024630.4(RUNX2):c.476G>A (p.Gly159Asp)	rs864621970	Cleidocranial dysostosis	9164	Pathogenic
6:45399656	NM_001024630.4(RUNX2):c.480C>T (p.Asn160=)	NA	not provided	9168	Likely benign
6:45399657	NM_001024630.4(RUNX2):c.481G>A (p.Asp161Asn)	rs1477047335	Cleidocranial dysostosis\|not provided	9169	Uncertain significance
6:45399657	NM_001024630.4(RUNX2):c.483_485del (p.Asp161del)	NA	Cleidocranial dysostosis	9169	Likely pathogenic
6:45399681	NM_001024630.4(RUNX2):c.505C>T (p.Arg169Trp)	rs1203066173	Cleidocranial dysostosis\|not provided	9193	Likely pathogenic
6:45399682	NM_001024630.4(RUNX2):c.506G>C (p.Arg169Pro)	rs104893995	Cleidocranial dysostosis	9194	Pathogenic
6:45399682	NM_001024630.4(RUNX2):c.506G>C (p.Arg169Pro)	rs104893995	Cleidocranial dysostosis	9194	Pathogenic
6:45399682	NM_001024630.4(RUNX2):c.506G>A (p.Arg169Gln)	NA	Cleidocranial dysostosis	9194	Pathogenic
6:45399691	NM_001024630.4(RUNX2):c.516dup (p.Ala173fs)	NA	not provided	9203	Pathogenic
6:45399699	NM_001024630.4(RUNX2):c.523A>G (p.Met175Val)	rs201647225	Cleidocranial dysostosis	9211	Conflicting interpretations of pathogenicity
6:45399700	NM_001024630.4(RUNX2):c.524T>G (p.Met175Arg)	rs104893989	Cleidocranial dysostosis	9212	Pathogenic
6:45399700	NM_001024630.4(RUNX2):c.524T>G (p.Met175Arg)	rs104893989	Cleidocranial dysostosis	9212	Pathogenic
6:45399707	NM_001024630.4(RUNX2):c.531C>G (p.Asn177Lys)	rs147359883	not provided	9219	Conflicting interpretations of pathogenicity
6:45399715	NM_001024630.4(RUNX2):c.539C>A (p.Ala180Glu)	NA	Cleidocranial dysostosis	9227	Pathogenic
6:45399725	NM_001024630.4(RUNX2):c.549C>T (p.Asn183=)	rs115974315	not provided	9237	Benign
6:45399744	NM_001024630.4(RUNX2):c.568C>T (p.Arg190Trp)	NA	not provided\|not specified	9256	Pathogenic
6:45399745	NM_001024630.4(RUNX2):c.569G>A (p.Arg190Gln)	rs1057521068	not provided\|Cleidocranial dysostosis	9257	Pathogenic/Likely pathogenic
6:45399748	NM_001024630.4(RUNX2):c.572G>A (p.Ser191Asn)	rs104893990	Cleidocranial dysostosis	9260	Pathogenic
6:45399748	NM_001024630.4(RUNX2):c.572G>A (p.Ser191Asn)	rs104893990	Cleidocranial dysostosis	9260	Pathogenic
6:45399753	NM_001024630.4(RUNX2):c.577C>T (p.Arg193Ter)	rs1582105417	Cleidocranial dysostosis\|not provided	9265	Pathogenic
6:45399754	NM_001024630.4(RUNX2):c.578G>A (p.Arg193Gln)	NA	not provided	9266	Uncertain significance
6:45399768	NM_001024630.4(RUNX2):c.580+12A>G	NA	not provided	9280	Benign
6:45405590	NM_001024630.4(RUNX2):c.581-94A>T	NA	not provided	15102	Benign
6:45405664	NC_000006.11:g.(?_45405664)_(45480164_?)del	NA	not provided	15176	Pathogenic
6:45405675	NM_001024630.4(RUNX2):c.581-9T>C	rs374414428	Cleidocranial dysostosis\|not provided	15187	Benign/Likely benign
6:45405679	NM_001024630.4(RUNX2):c.581-5T>C	NA	not provided	15191	Likely benign
6:45405683	NM_001024630.4(RUNX2):c.581-1G>A	NA	Cleidocranial dysostosis	15195	Pathogenic
6:45405689	NM_001024630.4(RUNX2):c.586A>G (p.Ser196Gly)	NA	not provided	15201	Uncertain significance
6:45405697	NM_001024630.4(RUNX2):c.594_595delinsG (p.Thr198_Leu199insTer)	rs1798733144	Cleidocranial dysostosis	15209	Pathogenic
6:45405700	NM_001024630.4(RUNX2):c.597G>T (p.Leu199Phe)	NA	not provided	15212	Likely pathogenic
6:45405701	NM_001024630.4(RUNX2):c.598A>G (p.Thr200Ala)	rs104893993	Cleidocranial dysostosis\|Cleidocranial dysplasia, forme fruste, dental anomalies only	15213	Pathogenic
6:45405701	NM_001024630.4(RUNX2):c.598A>G (p.Thr200Ala)	rs104893993	Cleidocranial dysostosis\|Cleidocranial dysplasia, forme fruste, dental anomalies only	15213	Pathogenic
6:45405706	NM_001024630.4(RUNX2):c.604del (p.Thr202fs)	NA	not provided	15218	Pathogenic
6:45405710	NM_001024630.4(RUNX2):c.607G>A (p.Val203Ile)	NA	not provided	15222	Uncertain significance
6:45405716	NM_001024630.4(RUNX2):c.613A>G (p.Thr205Ala)	rs762910660	Cleidocranial dysostosis	15228	Uncertain significance
6:45405718	NM_001024630.4(RUNX2):c.617del (p.Asn206fs)	NA	not provided	15230	Pathogenic
6:45405734	NM_001024630.4(RUNX2):c.631G>C (p.Ala211Pro)	NA	not provided	15246	Uncertain significance
6:45405737	NM_001024630.4(RUNX2):c.636dup (p.Tyr213fs)	rs1798735440	Cleidocranial dysostosis	15249	Pathogenic
6:45405750	NM_001024630.4(RUNX2):c.647C>A (p.Ala216Glu)	rs1798735983	not provided	15262	Uncertain significance
6:45405753	NM_001024630.4(RUNX2):c.650T>G (p.Ile217Ser)	NA	not provided	15265	Uncertain significance
6:45405755	NM_001024630.4(RUNX2):c.652A>G (p.Lys218Glu)	NA	not provided	15267	Pathogenic
6:45405762	NM_001024630.4(RUNX2):c.659C>T (p.Thr220Ile)	NA	not provided	15274	Pathogenic
6:45405763	NM_001024630.4(RUNX2):c.660A>G (p.Thr220=)	NA	not provided	15275	Likely benign
6:45405766	NM_001024630.4(RUNX2):c.663A>G (p.Val221=)	rs115763613	Cleidocranial dysostosis\|not provided	15278	Benign/Likely benign
6:45405767	NM_001024630.4(RUNX2):c.664G>C (p.Asp222His)	rs1798736907	not provided	15279	Likely pathogenic
6:45405768	NM_001024630.4(RUNX2):c.665A>G (p.Asp222Gly)	NA	not provided	15280	Likely pathogenic
6:45405776	NM_001024630.4(RUNX2):c.673C>T (p.Arg225Trp)	rs104893992	Cleidocranial dysostosis\|not provided	15288	Pathogenic
6:45405776	NM_001024630.4(RUNX2):c.673C>T (p.Arg225Trp)	rs104893992	Cleidocranial dysostosis\|not provided	15288	Pathogenic
6:45405777	NM_001024630.4(RUNX2):c.674G>A (p.Arg225Gln)	rs104893991	Cleidocranial dysostosis\|not provided	15289	Pathogenic
6:45405777	NM_001024630.4(RUNX2):c.674G>A (p.Arg225Gln)	rs104893991	Cleidocranial dysostosis\|not provided	15289	Pathogenic
6:45405777	NM_001024630.4(RUNX2):c.674G>T (p.Arg225Leu)	NA	Cleidocranial dysostosis	15289	not provided
6:45405793	NM_001024630.4(RUNX2):c.685+5G>A	rs1798738030	Cleidocranial dysostosis	15305	Uncertain significance
6:45422617	NM_001024630.4(RUNX2):c.90dup (p.Ser31fs)	rs397515538	Cleidocranial dysostosis	32129	not provided
6:45422694	NM_001024630.4(RUNX2):c.172CAACAGCAGCAGCAGCAGCAG[1] (p.Gln65_Gln71del)	rs774172072	not specified\|not provided	32206	Conflicting interpretations of pathogenicity
6:45422723	NM_001024630.4(RUNX2):c.189_203delinsACAGCAGCAGCAGCAGCAGCAACAGCAGCCG (p.Glu72fs)	rs730880313	Cleidocranial dysostosis	32235	Pathogenic
6:45422753	NM_001024630.4(RUNX2):c.231_260dup (p.Ala80_Ala89dup)	rs606231174	Cleidocranial dysplasia, forme fruste, with brachydactyly	32265	Pathogenic
6:45422774	NM_001024630.4(RUNX2):c.240G>A (p.Ala80=)	rs6921145	not specified\|Cleidocranial dysostosis\|not provided	32286	Benign
6:45431915	NM_001024630.4(RUNX2):c.476G>A (p.Gly159Asp)	rs864621970	Cleidocranial dysostosis	41427	Pathogenic
6:45431945	NM_001024630.4(RUNX2):c.506G>C (p.Arg169Pro)	rs104893995	Cleidocranial dysostosis	41457	Pathogenic
6:45431963	NM_001024630.4(RUNX2):c.524T>G (p.Met175Arg)	rs104893989	Cleidocranial dysostosis	41475	Pathogenic
6:45432011	NM_001024630.4(RUNX2):c.572G>A (p.Ser191Asn)	rs104893990	Cleidocranial dysostosis	41523	Pathogenic
6:45437964	NM_001024630.4(RUNX2):c.598A>G (p.Thr200Ala)	rs104893993	Cleidocranial dysostosis\|Cleidocranial dysplasia, forme fruste, dental anomalies only	47476	Pathogenic
6:45438039	NM_001024630.4(RUNX2):c.673C>T (p.Arg225Trp)	rs104893992	Cleidocranial dysostosis\|not provided	47551	Pathogenic
6:45438040	NM_001024630.4(RUNX2):c.674G>A (p.Arg225Gln)	rs104893991	Cleidocranial dysostosis\|not provided	47552	Pathogenic

Position	Population	BlockLength (kb)	Distance	Location with respect to STR	No. of SNPs	SNPs in the Haploblock
6:45348633-45357699	AFR	9.067	-41855	downstream	12	rs11968637, rs9472477, rs17288327, rs4510673, rs77735959, rs17288334, rs73441910, rs12209727, rs62400336, rs1321081, rs116373813, rs239650,
6:45352015-45357742	EAS	5.728	-38473	downstream	9	rs76451089, rs12209727, rs62400336, rs12525950, rs1321081, rs10948231, rs717987, rs2396502, rs587592,
6:45357742-45357980	AMR	0.239	-32746	downstream	2	rs5875920, rs14781012,
6:45357980-45358107	EAS	0.128	-32508	downstream	2	rs147810129, rs690865,
6:45358107-45358403	AFR	0.297	-32381	downstream	3	rs6908650, rs1321080, rs132107,
6:45358107-45358323	all_pop	0.217	-32381	downstream	2	rs6908650, rs132108,
6:45358107-45362055	AMR	3.949	-32381	downstream	18	rs6908650, rs1321080, rs1321079, rs11966902, rs12201563, rs11968177, rs9395099, rs77329398, rs35963405, rs12211510, rs111514840, rs138064235, rs149513790, rs144011454, rs151005683, rs57013196, rs72862930, rs157506,
6:45358107-45367496	EUR	9.39	-32381	downstream	34	rs6908650, rs1321080, rs1321079, rs11966902, rs9472482, rs12201563, rs11968177, rs9395099, rs77329398, rs35963405, rs12211510, rs111514840, rs138064235, rs149513790, rs144011454, rs151005683, rs57013196, rs72862930, rs1575060, rs111425365, rs10498760, rs10948233, rs75142593, rs115418113, rs111750022, rs1852984, rs1852983, rs56789892, rs11963804, rs11966462, rs144174836, rs17288355, rs111517073, rs14896835,
6:45358107-45395138	SAS	37.032	-32381	downstream	105	rs6908650, rs1321080, rs1321079, rs11966902, rs12201563, rs11968177, rs9395099, rs77329398, rs35963405, rs12211510, rs111514840, rs138064235, rs149513790, rs144011454, rs151005683, rs57013196, rs72862930, rs1575060, rs111425365, rs10498760, rs10948233, rs75142593, rs115418113, rs111750022, rs1852984, rs1852983, rs12664292, rs56789892, rs11963804, rs11966462, rs17288355, rs111517073, rs148968352, rs72862937, rs62400349, rs62400350, rs1321078, rs9357487, rs61467394, rs9296459, rs58571027, rs7749637, rs10456553, rs9472487, rs7770471, rs17288376, rs199677146, rs17209846, rs1997995, rs1977152, rs10948234, rs17209853, rs7742209, rs77735520, rs55875203, rs2064630, rs78488630, rs75864224, rs75988681, rs79805935, rs79359769, rs35549153, rs13215406, rs2064628, rs113673672, rs76954735, rs4413613, rs4413614, rs4370348, rs17209874, rs77252578, rs1004130, rs17288390, rs75205636, rs142273566, rs7768466, rs7768666, rs17288397, rs34787815, rs77131077, rs12197755, rs74872917, rs62400353, rs141199367, rs7751427, rs7771980, rs6921145, rs3749864, rs11498195, rs11498196, rs3805810, rs3840375, rs11332168, rs3805811, rs1321076, rs1321075, rs3792952, rs3828722, rs3828723, rs2894641, rs9369561, rs9395101, rs12192267, rs75870189, rs222411,
6:45358403-45371222	all_pop	12.82	-32085	downstream	43	rs1321079, rs11966902, rs9472482, rs12201563, rs11968177, rs9395099, rs77329398, rs35963405, rs12211510, rs111514840, rs138064235, rs149513790, rs144011454, rs151005683, rs57013196, rs72862930, rs1575060, rs111425365, rs10498760, rs10948233, rs75142593, rs115418113, rs111750022, rs1852984, rs1852983, rs12664292, rs56789892, rs11963804, rs11966462, rs144174836, rs17288355, rs111517073, rs148968352, rs72862937, rs62400349, rs62400350, rs1321078, rs61467394, rs9296459, rs148641889, rs58571027, rs7749637, rs1045655,
6:45358413-45396319	EAS	37.907	-32075	downstream	103	rs11966902, rs11968177, rs9395099, rs77329398, rs35963405, rs111514840, rs138064235, rs149513790, rs144011454, rs57013196, rs1575060, rs111425365, rs10498760, rs75142593, rs115418113, rs111750022, rs12664292, rs56789892, rs11963804, rs75733103, rs11966462, rs17288355, rs111517073, rs148968352, rs72862937, rs9357487, rs61467394, rs9296459, rs58571027, rs7749637, rs9472487, rs7770471, rs2396501, rs17288376, rs199677146, rs17209846, rs16873396, rs1997995, rs1977152, rs10948234, rs17209853, rs7742209, rs73441925, rs77735520, rs2064630, rs78488630, rs2064629, rs75864224, rs75988681, rs79805935, rs79359769, rs16873401, rs35549153, rs13215406, rs113673672, rs149288886, rs76954735, rs4413613, rs4413614, rs4370348, rs17209874, rs77252578, rs1004130, rs1467458, rs1467457, rs17288390, rs75205636, rs142273566, rs7768466, rs7768666, rs17288397, rs34787815, rs77131077, rs74872917, rs141199367, rs7751427, rs7771980, rs6921145, rs3749864, rs11498195, rs11498196, rs3805810, rs3840375, rs11332168, rs3805811, rs3805812, rs1321076, rs1321075, rs3792952, rs3828722, rs3828723, rs9369561, rs9395101, rs75870189, rs73441934, rs2224118, rs2819860, rs2677105, rs2677104, rs3805818, rs78645638, rs2819859, rs281985,
6:45358429-45360501	AFR	2.073	-32059	downstream	3	rs9472482, rs35963405, rs7481305,
6:45361113-45362055	AFR	0.943	-29375	downstream	4	rs73441917, rs12211510, rs72862930, rs157506,
6:45363407-45379641	AFR	16.235	-27081	downstream	24	rs79549650, rs57223738, rs144174836, rs150111215, rs7766736, rs72862937, rs150850439, rs77158371, rs9296459, rs148641889, rs7749637, rs7770471, rs2396501, rs74809661, rs16873396, rs1997995, rs1997994, rs10948234, rs7742209, rs73441925, rs2064630, rs74474020, rs77003447, rs1687340,
6:45363556-45395138	AMR	31.583	-26932	downstream	91	rs111425365, rs10498760, rs10948233, rs75142593, rs115418113, rs111750022, rs1852984, rs1852983, rs56789892, rs11963804, rs11966462, rs17288355, rs111517073, rs148968352, rs72862937, rs62400349, rs62400350, rs1321078, rs61467394, rs9296459, rs58571027, rs7749637, rs10456553, rs9472487, rs7770471, rs2396501, rs17288376, rs199677146, rs17209846, rs16873396, rs1997995, rs1977152, rs10948234, rs17209853, rs7742209, rs77735520, rs55875203, rs2064630, rs78488630, rs2064629, rs75864224, rs75988681, rs79805935, rs79359769, rs35549153, rs13215406, rs2064628, rs11962735, rs113673672, rs76954735, rs4413613, rs4413614, rs4370348, rs17209874, rs77252578, rs1004130, rs1467458, rs17288390, rs75205636, rs142273566, rs7768466, rs7768666, rs17288397, rs34787815, rs77131077, rs12197755, rs74872917, rs62400353, rs141199367, rs7751427, rs7771980, rs6921145, rs3749864, rs11498195, rs11498196, rs3805810, rs3840375, rs11332168, rs3805811, rs1321076, rs1321075, rs3792952, rs3828722, rs3828723, rs2894641, rs9369561, rs9395101, rs12192267, rs75870189, rs73441934, rs222411,
6:45367617-45371222	EUR	3.606	-22871	downstream	10	rs72862937, rs62400349, rs62400350, rs1321078, rs61467394, rs9296459, rs148641889, rs58571027, rs7749637, rs1045655,
6:45371366-45371553	all_pop	0.188	-19122	downstream	2	rs9472487, rs777047,
6:45371366-45395138	EUR	23.773	-19122	downstream	73	rs9472487, rs7770471, rs2396501, rs17288376, rs199677146, rs17209846, rs1997995, rs1977152, rs10948234, rs17209853, rs7742209, rs77735520, rs1321077, rs55875203, rs12206662, rs2064630, rs78488630, rs2064629, rs75864224, rs75988681, rs79805935, rs79359769, rs35549153, rs13215406, rs549531306, rs2064628, rs11962735, rs113673672, rs76954735, rs4413613, rs4413614, rs4370348, rs17209874, rs77252578, rs1004130, rs1467458, rs17288390, rs75205636, rs142273566, rs7768466, rs7768666, rs17288397, rs34787815, rs77131077, rs79608764, rs12197755, rs74872917, rs62400353, rs141199367, rs7751427, rs7771980, rs6921145, rs3749864, rs11498195, rs11498196, rs3805810, rs3840375, rs11332168, rs3805811, rs1321076, rs1321075, rs3792952, rs113308638, rs3828722, rs3828723, rs2894641, rs9369561, rs9395101, rs12192267, rs9472489, rs75870189, rs13437231, rs222411,
6:45372218-45394252	all_pop	22.035	-18270	downstream	67	rs17288376, rs199677146, rs17209846, rs16873396, rs1997995, rs1977152, rs10948234, rs17209853, rs7742209, rs77735520, rs55875203, rs2064630, rs78488630, rs2064629, rs75864224, rs75988681, rs79805935, rs79359769, rs16873401, rs35549153, rs13215406, rs549531306, rs2064628, rs113673672, rs149288886, rs76954735, rs4413613, rs4413614, rs4370348, rs17209874, rs77252578, rs1004130, rs1467458, rs17288390, rs75205636, rs142273566, rs7768466, rs7768666, rs17288397, rs34787815, rs77131077, rs79608764, rs12197755, rs74872917, rs62400353, rs141199367, rs7751427, rs7771980, rs6921145, rs3749864, rs11498195, rs11498196, rs3805810, rs3840375, rs11332168, rs3805811, rs1321076, rs1321075, rs3792952, rs3828722, rs3828723, rs2894641, rs9369561, rs9395101, rs12192267, rs9472489, rs7587018,
6:45380531-45388358	AFR	7.828	-9957	downstream	8	rs2064628, rs149288886, rs1467457, rs17288390, rs34787815, rs79608764, rs78308743, rs7744680,
6:45389658-45395138	AFR	5.481	-830	downstream	19	rs74865052, rs111913609, rs3805810, rs76310809, rs11332168, rs575522483, rs3805811, rs3805812, rs1321076, rs1321075, rs78814361, rs9369561, rs9395101, rs73737413, rs9472489, rs146800170, rs73441934, rs13437231, rs222411,
6:45394741-45395138	all_pop	0.398	4253	upstream	2	rs13437231, rs222411,
6:45395789-45395792	AFR	0.004	5301	upstream	2	rs2819860, rs267710,
6:45395789-45395792	all_pop	0.004	5301	upstream	2	rs2819860, rs267710,
6:45395789-45395792	AMR	0.004	5301	upstream	2	rs2819860, rs267710,
6:45395789-45395792	EUR	0.004	5301	upstream	2	rs2819860, rs267710,
6:45395789-45395792	SAS	0.004	5301	upstream	2	rs2819860, rs267710,
6:45395869-45396319	AFR	0.451	5381	upstream	4	rs60180065, rs2677104, rs2819859, rs281985,
6:45395873-45396319	all_pop	0.447	5385	upstream	5	rs2677104, rs3805818, rs78645638, rs2819859, rs281985,
6:45395873-45396319	AMR	0.447	5385	upstream	5	rs2677104, rs3805818, rs78645638, rs2819859, rs281985,
6:45395873-45396544	EUR	0.672	5385	upstream	6	rs2677104, rs3805818, rs78645638, rs2819859, rs2819858, rs267710,
6:45395873-45396319	SAS	0.447	5385	upstream	5	rs2677104, rs3805818, rs78645638, rs2819859, rs281985,
6:45396592-45404528	EUR	7.937	6104	upstream	21	rs565953603, rs2677102, rs2819857, rs112084677, rs59397804, rs2677101, rs12203052, rs78417039, rs17209881, rs2819855, rs1406846, rs141292854, rs9463087, rs17209895, rs140838642, rs2677108, rs113166183, rs73441953, rs74587175, rs1997992, rs281985,
6:45397050-45397779	AFR	0.73	6562	upstream	3	rs2677102, rs2819857, rs11234767,
6:45397050-45404528	all_pop	7.479	6562	upstream	18	rs2677102, rs2819857, rs59397804, rs2677101, rs12203052, rs78417039, rs17209881, rs2819855, rs1406846, rs141292854, rs9463087, rs17209895, rs2677108, rs113166183, rs73441953, rs74587175, rs1997992, rs281985,
6:45397050-45404230	AMR	7.181	6562	upstream	14	rs2677102, rs2819857, rs59397804, rs2677101, rs12203052, rs78417039, rs17209881, rs2819855, rs1406846, rs141292854, rs17209895, rs2677108, rs73441953, rs199799,
6:45397050-45400146	EAS	3.097	6562	upstream	7	rs2677102, rs2819857, rs59397804, rs2677101, rs75205081, rs78417039, rs1720988,
6:45397050-45403774	SAS	6.725	6562	upstream	13	rs2677102, rs2819857, rs59397804, rs2677101, rs12203052, rs78417039, rs17209881, rs2819855, rs1406846, rs141292854, rs17209895, rs149137540, rs267710,
6:45400394-45400940	AFR	0.547	9906	upstream	2	rs2819855, rs140684,
6:45400394-45404230	EAS	3.837	9906	upstream	6	rs2819855, rs1406846, rs80349529, rs149137540, rs2677108, rs199799,
6:45401698-45404528	AFR	2.831	11210	upstream	8	rs9463087, rs150999186, rs2677108, rs113166183, rs73441953, rs74587175, rs1997992, rs281985,
6:45404230-45404528	SAS	0.299	13742	upstream	2	rs1997992, rs281985,
6:45405590-45406548	AFR	0.959	15102	upstream	3	rs77780637, rs114390410, rs11605159,
6:45407517-45412657	AFR	5.141	17029	upstream	11	rs57692088, rs79252285, rs2677109, rs6458443, rs78283128, rs77477952, rs115582073, rs910586, rs79801023, rs73441957, rs281985,
6:45407517-45407654	all_pop	0.138	17029	upstream	2	rs57692088, rs267710,
6:45407654-45412657	AMR	5.004	17166	upstream	6	rs2677109, rs6458443, rs78578960, rs910586, rs73441957, rs281985,
6:45407654-45420330	EAS	12.677	17166	upstream	5	rs2677109, rs78578960, rs73441957, rs2820339, rs1252638,
6:45407654-45451836	EUR	44.183	17166	upstream	48	rs2677109, rs6458443, rs78578960, rs910586, rs34454023, rs2819853, rs765724, rs2819852, rs2256819, rs2820339, rs2819867, rs2677099, rs2677100, rs2819863, rs1343799, rs2820340, rs2819861, rs530367604, rs35405209, rs2252718, rs2790100, rs34117694, rs2790102, rs2790103, rs9885645, rs2677098, rs2790093, rs2790094, rs2819864, rs2790095, rs2790097, rs1317777, rs2790098, rs35187443, rs2819865, rs2790099, rs2677110, rs35663521, rs11332021, rs2819866, rs1934327, rs35064270, rs10214519, rs4714854, rs12210100, rs4711816, rs5875923, rs947249,
6:45408440-45412657	all_pop	4.218	17952	upstream	5	rs6458443, rs78578960, rs910586, rs73441957, rs281985,
6:45408440-45424940	SAS	16.501	17952	upstream	14	rs6458443, rs910586, rs2819853, rs765724, rs2819852, rs2256819, rs2820339, rs2819867, rs2677099, rs12526388, rs2677100, rs1343799, rs2820340, rs281986,
6:45413479-45414370	AFR	0.892	22991	upstream	2	rs9472491, rs6093843,
6:45417118-45424940	AFR	7.823	26630	upstream	16	rs765724, rs2819852, rs74970061, rs114812505, rs2256819, rs77949461, rs2820339, rs2819867, rs2677099, rs7751050, rs77666763, rs2677100, rs1343799, rs7740986, rs2820340, rs281986,
6:45417118-45425250	all_pop	8.133	26630	upstream	12	rs765724, rs2819852, rs2256819, rs2820339, rs2819867, rs2677099, rs7751050, rs2677100, rs1343799, rs2820340, rs2819861, rs11173898,
6:45417118-45453383	AMR	36.266	26630	upstream	58	rs765724, rs2819852, rs2256819, rs2820339, rs2819867, rs2677099, rs7751050, rs2677100, rs1343799, rs78412780, rs2820340, rs2819861, rs111738988, rs530367604, rs11394370, rs35405209, rs75936328, rs2252718, rs2790100, rs34117694, rs2790102, rs2790103, rs73448153, rs6905689, rs9885645, rs117152785, rs2677098, rs2790093, rs2790094, rs2819864, rs2790095, rs2790097, rs1317777, rs73448156, rs76591181, rs2790098, rs35187443, rs2819865, rs73448159, rs2790099, rs2677110, rs35663521, rs11332021, rs2819866, rs1934327, rs10214519, rs12665622, rs4714854, rs12210100, rs16873429, rs4711816, rs5875923, rs80225269, rs9472494, rs73448164, rs199954113, rs9463090, rs775614,
6:45420631-45441929	EAS	21.299	30143	upstream	15	rs7751050, rs78412780, rs111738988, rs530367604, rs11394370, rs35405209, rs75936328, rs16873427, rs34117694, rs2790102, rs73448153, rs6905689, rs117152785, rs73448156, rs7659118,
6:45426121-45451088	all_pop	24.968	35633	upstream	39	rs11394370, rs35405209, rs75936328, rs2252718, rs2790100, rs34117694, rs2790102, rs2790103, rs16873428, rs73448153, rs6905689, rs9885645, rs117152785, rs2677098, rs2790093, rs2790094, rs2819864, rs2790095, rs2790097, rs1317777, rs73448156, rs76591181, rs2790098, rs35187443, rs2819865, rs73448159, rs2790099, rs2677110, rs35663521, rs11332021, rs2819866, rs1934327, rs10214519, rs12665622, rs4714854, rs12210100, rs16873429, rs4711816, rs587592,
6:45427596-45431712	AFR	4.117	37108	upstream	7	rs79250140, rs73448149, rs35405209, rs2252718, rs74584915, rs2790100, rs14583510,
6:45428508-45451836	SAS	23.329	38020	upstream	29	rs35405209, rs2252718, rs2790100, rs34117694, rs2790102, rs2790103, rs9885645, rs2677098, rs2790093, rs2790094, rs2819864, rs2790095, rs2790097, rs1317777, rs2790098, rs35187443, rs2819865, rs2790099, rs2677110, rs35663521, rs11332021, rs2819866, rs1934327, rs10214519, rs4714854, rs12210100, rs4711816, rs5875923, rs947249,
6:45432214-45442450	AFR	10.237	41726	upstream	22	rs2790102, rs2790103, rs16873428, rs115082237, rs73448153, rs6905689, rs137982736, rs9885645, rs79290473, rs2677098, rs2790093, rs111411480, rs80354510, rs2790094, rs2819864, rs2790095, rs2790097, rs1317777, rs73448156, rs550691417, rs58602572, rs279009,

No Alu found near the repeat

Conservation score was not calculated