STRIDE-DB

Repeat Length	AFR	AMR	EUR	EAS	SAS	Repeat
11.3	0	0	2	0	0	CCGCGGCCGCCGCCGCAGCCGCGGCCGCCGCCGC
11.7	168	54	266	80	158	CCGCGGCCGCCGCCGCAGCCGCGGCCGCCGCCGCC

Position	Disease/Trait	P-value	SNPs	Location with respect to STR	distance	Study
7:27191697	A body shape index,	1.0E-12	rs368928402	downstream	-47750	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27191697	Waist-to-hip ratio adjusted for BMI,	5.0E-14	rs368928402	downstream	-47750	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27191697	Waist-hip index,	7.0E-15	rs368928402	downstream	-47750	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27191804	Neutrophil count,	2.0E-10	rs62454420	downstream	-47643	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
7:27191804	Monocyte count,	2.0E-21	rs62454420	downstream	-47643	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
7:27191804	Monocyte count,	4.0E-19	rs62454420	downstream	-47643	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
7:27191804	Heel bone mineral density,	6.0E-11	rs62454420	downstream	-47643	Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
7:27191804	Heel bone mineral density,	5.0E-8	rs62454420	downstream	-47643	Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
7:27191804	Heel bone mineral density,	5.0E-21	rs62454420	downstream	-47643	Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
7:27191804	Monocyte count,	6.0E-15	rs62454420	downstream	-47643	The Polygenic and Monogenic Basis of Blood Traits and Diseases.
7:27197319	Endometriosis or asthma (pleiotropy),	8.0E-6	rs4722665	downstream	-42128	Genetic overlap analysis of endometriosis and asthma identifies shared loci implicating sex hormones and thyroid signalling pathways.
7:27197319	Lung function (FEV1/FVC),	5.0E-12	rs4722665	downstream	-42128	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
7:27200855	A body shape index,	3.0E-16	rs875897	downstream	-38592	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27200855	Waist-to-hip ratio adjusted for BMI,	1.0E-18	rs875897	downstream	-38592	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27200855	Waist-hip index,	1.0E-19	rs875897	downstream	-38592	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27200855	Waist circumference adjusted for body mass index,	2.0E-13	rs875897	downstream	-38592	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27200905	Pulse pressure,	5.0E-8	rs875898	downstream	-38542	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27201532	A body shape index,	7.0E-9	rs875896	downstream	-37915	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27201532	Waist-to-hip ratio adjusted for BMI,	6.0E-12	rs875896	downstream	-37915	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27201532	Waist-hip index,	2.0E-12	rs875896	downstream	-37915	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27201532	Waist circumference adjusted for body mass index,	3.0E-8	rs875896	downstream	-37915	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27202289	Monocyte percentage of white cells,	6.0E-10	rs10259620	downstream	-37158	The Polygenic and Monogenic Basis of Blood Traits and Diseases.
7:27203139	A body shape index,	2.0E-8	rs7810502	downstream	-36308	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27204653	Monocyte count,	4.0E-9	rs147261225	downstream	-34794	Whole-exome imputation within UK Biobank powers rare coding variant association and fine-mapping analyses.
7:27204732	Mosaic loss of chromosome Y (Y chromosome dosage),	9.0E-25	rs35355140	downstream	-34715	GWAS of mosaic loss of chromosome Y highlights genetic effects on blood cell differentiation.
7:27204732	Mosaic loss of chromosome Y (Y chromosome dosage),	2.0E-13	rs35355140	downstream	-34715	GWAS of mosaic loss of chromosome Y highlights genetic effects on blood cell differentiation.
7:27204732	Platelet count,	7.0E-13	rs35355140	downstream	-34715	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
7:27204732	White blood cell count,	7.0E-12	rs35355140	downstream	-34715	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
7:27204732	Platelet count,	2.0E-11	rs35355140	downstream	-34715	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
7:27204732	Platelet count,	4.0E-9	rs35355140	downstream	-34715	The Polygenic and Monogenic Basis of Blood Traits and Diseases.
7:27204732	White blood cell count,	6.0E-9	rs35355140	downstream	-34715	A cross-population atlas of genetic associations for 220 human phenotypes.
7:27204732	Monocyte count,	3.0E-12	rs35355140	downstream	-34715	A cross-population atlas of genetic associations for 220 human phenotypes.
7:27204732	Platelet count,	5.0E-9	rs35355140	downstream	-34715	A cross-population atlas of genetic associations for 220 human phenotypes.
7:27204732	Plateletcrit,	1.0E-12	rs35355140	downstream	-34715	The Polygenic and Monogenic Basis of Blood Traits and Diseases.
7:27205282	Waist-to-hip ratio adjusted for BMI,	2.0E-15	rs3801776	downstream	-34165	Shared Genetic and Experimental Links between Obesity-Related Traits and Asthma Subtypes in UK Biobank.
7:27206019	Waist-to-hip ratio adjusted for BMI,	2.0E-17	rs17501007	downstream	-33428	Shared Genetic and Experimental Links between Obesity-Related Traits and Asthma Subtypes in UK Biobank.
7:27206019	Waist circumference adjusted for body mass index,	8.0E-10	rs17501007	downstream	-33428	Shared Genetic and Experimental Links between Obesity-Related Traits and Asthma Subtypes in UK Biobank.
7:27206688	Red blood cell count,	1.0E-18	rs11773804	downstream	-32759	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
7:27206688	Red blood cell count,	5.0E-15	rs11773804	downstream	-32759	The Polygenic and Monogenic Basis of Blood Traits and Diseases.
7:27206688	Red blood cell count,	7.0E-13	rs11773804	downstream	-32759	A cross-population atlas of genetic associations for 220 human phenotypes.
7:27208018	Mean corpuscular volume,	3.0E-13	rs2237336	downstream	-31429	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
7:27208018	Mean corpuscular volume,	7.0E-16	rs2237336	downstream	-31429	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
7:27208018	Mean corpuscular volume,	4.0E-12	rs2237336	downstream	-31429	The Polygenic and Monogenic Basis of Blood Traits and Diseases.
7:27208018	Waist-hip index,	4.0E-8	rs2237336	downstream	-31429	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27208280	Mean corpuscular hemoglobin,	7.0E-14	rs2071243	downstream	-31167	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
7:27208280	Red blood cell count,	1.0E-20	rs2071243	downstream	-31167	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
7:27208280	Red blood cell count,	6.0E-21	rs2071243	downstream	-31167	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
7:27208280	Mean corpuscular hemoglobin,	2.0E-16	rs2071243	downstream	-31167	Trans-ethnic and Ancestry-Specific Blood-Cell Genetics in 746,667 Individuals from 5 Global Populations.
7:27208280	Mean corpuscular hemoglobin,	2.0E-18	rs2071243	downstream	-31167	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
7:27208280	Mean corpuscular hemoglobin,	1.0E-11	rs2071243	downstream	-31167	The Polygenic and Monogenic Basis of Blood Traits and Diseases.
7:27208280	Mean corpuscular hemoglobin,	1.0E-10	rs2071243	downstream	-31167	A cross-population atlas of genetic associations for 220 human phenotypes.
7:27211548	Waist-to-hip ratio adjusted for BMI,	7.0E-9	rs34957925	downstream	-27899	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27211548	Waist-hip index,	2.0E-9	rs34957925	downstream	-27899	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27214557	Heel bone mineral density,	2.0E-24	rs3779456	downstream	-24890	An atlas of genetic influences on osteoporosis in humans and mice.
7:27218419	Lung function (FVC),	3.0E-12	rs1859164	downstream	-21028	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
7:27218468	Heel bone mineral density,	1.0E-30	rs1859165	downstream	-20979	Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
7:27220831	Systolic blood pressure,	3.0E-11	rs6461992	downstream	-18616	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27220831	Diastolic blood pressure,	6.0E-11	rs6461992	downstream	-18616	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27220831	Mean arterial pressure,	2.0E-12	rs6461992	downstream	-18616	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27220831	Hypertension,	1.0E-8	rs6461992	downstream	-18616	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27220831	Hypertension,	7.0E-9	rs6461992	downstream	-18616	Ordered multinomial regression for genetic association analysis of ordinal phenotypes at Biobank scale.
7:27220831	Systolic blood pressure,	9.0E-24	rs6461992	downstream	-18616	Genome-wide association analysis identifies novel blood pressure loci and offers biological insights into cardiovascular risk.
7:27221454	Heel bone mineral density,	5.0E-34	rs17501090	downstream	-17993	An atlas of genetic influences on osteoporosis in humans and mice.
7:27221454	Heel bone mineral density,	1.0E-28	rs17501090	downstream	-17993	Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
7:27221454	Heel bone mineral density,	2.0E-11	rs17501090	downstream	-17993	Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
7:27221454	Heel bone mineral density,	5.0E-7	rs17501090	downstream	-17993	Identification of 153 new loci associated with heel bone mineral density and functional involvement of GPC6 in osteoporosis.
7:27223082	A body shape index,	9.0E-13	rs17501111	downstream	-16365	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27223082	Waist-to-hip ratio adjusted for BMI,	4.0E-17	rs17501111	downstream	-16365	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27223082	Waist-hip index,	7.0E-18	rs17501111	downstream	-16365	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27223082	Waist circumference adjusted for body mass index,	5.0E-13	rs17501111	downstream	-16365	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27223771	Waist-hip ratio,	5.0E-8	rs7801581	downstream	-15676	Association of Genetic Variants Related to Gluteofemoral vs Abdominal Fat Distribution With Type 2 Diabetes, Coronary Disease, and Cardiovascular Risk Factors.
7:27223771	Waist-to-hip ratio adjusted for BMI,	7.0E-29	rs7801581	downstream	-15676	Association of Genetic Variants Related to Gluteofemoral vs Abdominal Fat Distribution With Type 2 Diabetes, Coronary Disease, and Cardiovascular Risk Factors.
7:27223771	Waist-hip ratio,	5.0E-8	rs7801581	downstream	-15676	New genetic loci link adipose and insulin biology to body fat distribution.
7:27223771	Waist-to-hip ratio adjusted for BMI,	7.0E-12	rs7801581	downstream	-15676	The Influence of Age and Sex on Genetic Associations with Adult Body Size and Shape: A Large-Scale Genome-Wide Interaction Study.
7:27223771	Waist-to-hip ratio adjusted for BMI x sex x age interaction (4df test),	2.0E-10	rs7801581	downstream	-15676	The Influence of Age and Sex on Genetic Associations with Adult Body Size and Shape: A Large-Scale Genome-Wide Interaction Study.
7:27223771	Waist-to-hip ratio adjusted for body mass index,	8.0E-6	rs7801581	downstream	-15676	New genetic loci link adipose and insulin biology to body fat distribution.
7:27223771	Waist-to-hip ratio adjusted for body mass index,	2.0E-6	rs7801581	downstream	-15676	New genetic loci link adipose and insulin biology to body fat distribution.
7:27223771	Waist-to-hip ratio adjusted for body mass index,	4.0E-10	rs7801581	downstream	-15676	New genetic loci link adipose and insulin biology to body fat distribution.
7:27223771	Waist-to-hip ratio adjusted for body mass index,	1.0E-6	rs7801581	downstream	-15676	New genetic loci link adipose and insulin biology to body fat distribution.
7:27223771	Waist-to-hip ratio adjusted for body mass index,	7.0E-6	rs7801581	downstream	-15676	New genetic loci link adipose and insulin biology to body fat distribution.
7:27223771	Waist-to-hip ratio adjusted for body mass index,	3.0E-10	rs7801581	downstream	-15676	New genetic loci link adipose and insulin biology to body fat distribution.
7:27223771	Waist-to-hip ratio adjusted for BMI,	1.0E-20	rs7801581	downstream	-15676	Shared Genetic and Experimental Links between Obesity-Related Traits and Asthma Subtypes in UK Biobank.
7:27223771	Waist circumference adjusted for body mass index,	2.0E-13	rs7801581	downstream	-15676	Shared Genetic and Experimental Links between Obesity-Related Traits and Asthma Subtypes in UK Biobank.
7:27223771	Height,	3.0E-17	rs7801581	downstream	-15676	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
7:27223771	Waist circumference adjusted for body mass index,	2.0E-6	rs7801581	downstream	-15676	New genetic loci link adipose and insulin biology to body fat distribution.
7:27223771	Waist circumference adjusted for body mass index,	8.0E-11	rs7801581	downstream	-15676	New genetic loci link adipose and insulin biology to body fat distribution.
7:27223771	Waist circumference adjusted for body mass index,	2.0E-7	rs7801581	downstream	-15676	New genetic loci link adipose and insulin biology to body fat distribution.
7:27223771	Waist-to-hip ratio adjusted for BMI (joint analysis for main effect and physical activity interaction),	5.0E-8	rs7801581	downstream	-15676	Genome-wide physical activity interactions in adiposity - A meta-analysis of 200,452 adults.
7:27223771	Waist circumference adjusted for BMI (adjusted for smoking behaviour),	3.0E-6	rs7801581	downstream	-15676	Genome-wide meta-analysis of 241,258 adults accounting for smoking behaviour identifies novel loci for obesity traits.
7:27223771	Waist-to-hip ratio adjusted for BMI (adjusted for smoking behaviour),	8.0E-9	rs7801581	downstream	-15676	Genome-wide meta-analysis of 241,258 adults accounting for smoking behaviour identifies novel loci for obesity traits.
7:27223771	Waist-to-hip ratio adjusted for BMI (adjusted for smoking behaviour),	3.0E-6	rs7801581	downstream	-15676	Genome-wide meta-analysis of 241,258 adults accounting for smoking behaviour identifies novel loci for obesity traits.
7:27223771	Waist circumference adjusted for BMI in non-smokers,	9.0E-7	rs7801581	downstream	-15676	Genome-wide meta-analysis of 241,258 adults accounting for smoking behaviour identifies novel loci for obesity traits.
7:27223771	Waist-to-hip ratio adjusted for BMI (joint analysis for main effect and physical activity interaction),	5.0E-8	rs7801581	downstream	-15676	Genome-wide physical activity interactions in adiposity - A meta-analysis of 200,452 adults.
7:27223771	Waist circumference adjusted for BMI (joint analysis main effects and smoking interaction),	1.0E-7	rs7801581	downstream	-15676	Genome-wide meta-analysis of 241,258 adults accounting for smoking behaviour identifies novel loci for obesity traits.
7:27223771	Waist circumference adjusted for BMI (adjusted for smoking behaviour),	9.0E-8	rs7801581	downstream	-15676	Genome-wide meta-analysis of 241,258 adults accounting for smoking behaviour identifies novel loci for obesity traits.
7:27223771	Waist circumference adjusted for body mass index,	2.0E-8	rs7801581	downstream	-15676	Genome-wide physical activity interactions in adiposity - A meta-analysis of 200,452 adults.
7:27223771	Waist-to-hip ratio adjusted for body mass index,	1.0E-6	rs7801581	downstream	-15676	Genome-wide physical activity interactions in adiposity - A meta-analysis of 200,452 adults.
7:27223771	Waist-to-hip ratio adjusted for body mass index,	6.0E-9	rs7801581	downstream	-15676	Genome-wide physical activity interactions in adiposity - A meta-analysis of 200,452 adults.
7:27223771	Waist-to-hip ratio adjusted for body mass index,	1.0E-8	rs7801581	downstream	-15676	Genome-wide physical activity interactions in adiposity - A meta-analysis of 200,452 adults.
7:27223771	Waist-to-hip ratio adjusted for BMI in active individuals,	4.0E-7	rs7801581	downstream	-15676	Genome-wide physical activity interactions in adiposity - A meta-analysis of 200,452 adults.
7:27223771	Waist-to-hip ratio adjusted for BMI in active individuals,	4.0E-7	rs7801581	downstream	-15676	Genome-wide physical activity interactions in adiposity - A meta-analysis of 200,452 adults.
7:27223771	Waist circumference adjusted for BMI in active individuals,	3.0E-7	rs7801581	downstream	-15676	Genome-wide physical activity interactions in adiposity - A meta-analysis of 200,452 adults.
7:27223771	Waist-to-hip ratio adjusted for BMI in active individuals,	6.0E-6	rs7801581	downstream	-15676	Genome-wide physical activity interactions in adiposity - A meta-analysis of 200,452 adults.
7:27223771	Waist-to-hip ratio adjusted for BMI in active individuals,	6.0E-6	rs7801581	downstream	-15676	Genome-wide physical activity interactions in adiposity - A meta-analysis of 200,452 adults.
7:27223771	Waist circumference adjusted for BMI (joint analysis main effects and physical activity interaction),	2.0E-7	rs7801581	downstream	-15676	Genome-wide physical activity interactions in adiposity - A meta-analysis of 200,452 adults.
7:27225489	Waist-to-hip ratio adjusted for BMI,	1.0E-14	rs61744408	downstream	-13958	Shared Genetic and Experimental Links between Obesity-Related Traits and Asthma Subtypes in UK Biobank.
7:27225489	Waist-to-hip ratio adjusted for BMI,	2.0E-9	rs61744408	downstream	-13958	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27225489	Waist-hip index,	1.0E-9	rs61744408	downstream	-13958	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27226788	Waist-hip ratio,	2.0E-26	rs4722669	downstream	-12659	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
7:27226788	Waist-to-hip ratio adjusted for BMI,	2.0E-27	rs4722669	downstream	-12659	Shared Genetic and Experimental Links between Obesity-Related Traits and Asthma Subtypes in UK Biobank.
7:27226788	Waist circumference adjusted for body mass index,	3.0E-17	rs4722669	downstream	-12659	Shared Genetic and Experimental Links between Obesity-Related Traits and Asthma Subtypes in UK Biobank.
7:27229119	Medication use (diuretics),	1.0E-28	rs916880	downstream	-10328	Genome-wide association study of medication-use and associated disease in the UK Biobank.
7:27231045	Heel bone mineral density,	8.0E-29	rs17472350	downstream	-8402	Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
7:27231045	Heel bone mineral density,	2.0E-38	rs17472350	downstream	-8402	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
7:27231762	Ulcerative colitis,	2.0E-8	rs4722672	downstream	-7685	Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease.
7:27231762	Ulcerative colitis,	5.0E-6	rs4722672	downstream	-7685	Association analyses identify 38 susceptibility loci for inflammatory bowel disease and highlight shared genetic risk across populations.
7:27232126	Body fat percentage,	8.0E-15	rs9770544	downstream	-7321	Genetic evidence for different adiposity phenotypes and their opposing influence on ectopic fat and risk of cardiometabolic disease.
7:27232126	Metabolic biomarkers (multivariate analysis),	5.0E-9	rs9770544	downstream	-7321	Genetic evidence for different adiposity phenotypes and their opposing influence on ectopic fat and risk of cardiometabolic disease.
7:27232126	A body shape index,	3.0E-9	rs9770544	downstream	-7321	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27232126	Waist-to-hip ratio adjusted for BMI,	5.0E-11	rs9770544	downstream	-7321	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27232126	Waist-hip index,	2.0E-11	rs9770544	downstream	-7321	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27232126	Waist circumference adjusted for body mass index,	2.0E-8	rs9770544	downstream	-7321	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27238287	Blood urea nitrogen levels,	5.0E-6	rs73073442	downstream	-1160	Discovery and prioritization of variants and genes for kidney function in >1.2 million individuals.
7:27238287	Estimated glomerular filtration rate (creatinine),	1.0E-10	rs73073442	downstream	-1160	Discovery and prioritization of variants and genes for kidney function in >1.2 million individuals.
7:27238287	Estimated glomerular filtration rate (creatinine),	4.0E-14	rs73073442	downstream	-1160	Epigenomic and transcriptomic analyses define core cell types, genes and targetable mechanisms for kidney disease.
7:27239550	Serum creatinine levels,	7.0E-12	rs35042646	upstream	103	A cross-population atlas of genetic associations for 220 human phenotypes.
7:27241473	Heel bone mineral density,	3.0E-22	rs17501292	upstream	2026	Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
7:27241660	Waist-hip ratio,	5.0E-14	rs2067087	upstream	2213	Meta-analysis of genome-wide association studies for body fat distribution in 694,649 individuals of European ancestry.
7:27241660	Diastolic blood pressure,	9.0E-12	rs2067087	upstream	2213	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27241660	Hypertension,	1.0E-9	rs2067087	upstream	2213	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27241660	Mean arterial pressure,	2.0E-13	rs2067087	upstream	2213	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27241660	Appendicular lean mass,	2.0E-13	rs2067087	upstream	2213	Genome-wide Associations Reveal Human-Mouse Genetic Convergence and Modifiers of Myogenesis, CPNE1 and STC2.
7:27241660	Systolic blood pressure,	9.0E-12	rs2067087	upstream	2213	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27241660	Diastolic blood pressure,	2.0E-10	rs2067087	upstream	2213	Genetic analysis of quantitative traits in the Japanese population links cell types to complex human diseases.
7:27241660	Mean arterial pressure,	3.0E-12	rs2067087	upstream	2213	Genetic analysis of quantitative traits in the Japanese population links cell types to complex human diseases.
7:27241660	Waist-to-hip ratio adjusted for BMI,	2.0E-20	rs2067087	upstream	2213	Meta-analysis of genome-wide association studies for body fat distribution in 694,649 individuals of European ancestry.
7:27241660	Hip index,	3.0E-8	rs2067087	upstream	2213	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27241660	Waist-hip index,	6.0E-12	rs2067087	upstream	2213	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27241660	Waist-to-hip ratio adjusted for BMI,	1.0E-11	rs2067087	upstream	2213	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27242359	Diastolic blood pressure,	5.0E-11	rs1859168	upstream	2912	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27242359	Systolic blood pressure,	5.0E-12	rs1859168	upstream	2912	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27242359	Mean arterial pressure,	6.0E-13	rs1859168	upstream	2912	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27242359	Hypertension,	4.0E-10	rs1859168	upstream	2912	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27242359	Diastolic blood pressure,	2.0E-20	rs1859168	upstream	2912	Novel Blood Pressure Locus and Gene Discovery Using Genome-Wide Association Study and Expression Data Sets From Blood and the Kidney.
7:27242359	Diastolic blood pressure,	1.0E-8	rs1859168	upstream	2912	Novel Blood Pressure Locus and Gene Discovery Using Genome-Wide Association Study and Expression Data Sets From Blood and the Kidney.
7:27243221	Microalbuminuria,	2.0E-6	rs2023843	upstream	3774	Genome-wide association meta-analyses and fine-mapping elucidate pathways influencing albuminuria.
7:27243221	Urinary albumin-to-creatinine ratio,	5.0E-14	rs2023843	upstream	3774	Genome-wide association meta-analyses and fine-mapping elucidate pathways influencing albuminuria.
7:27243221	Pulse pressure,	1.0E-16	rs2023843	upstream	3774	Trans-ethnic association study of blood pressure determinants in over 750,000 individuals.
7:27243221	Systolic blood pressure,	2.0E-6	rs2023843	upstream	3774	Genetic analyses of diverse populations improves discovery for complex traits.
7:27243221	Diastolic blood pressure x smoking status (current vs non-current) interaction (2df test),	2.0E-33	rs2023843	upstream	3774	A Large-Scale Multi-ancestry Genome-wide Study Accounting for Smoking Behavior Identifies Multiple Significant Loci for Blood Pressure.
7:27243221	Systolic blood pressure x smoking status (current vs non-current) interaction (2df test),	6.0E-29	rs2023843	upstream	3774	A Large-Scale Multi-ancestry Genome-wide Study Accounting for Smoking Behavior Identifies Multiple Significant Loci for Blood Pressure.
7:27243221	Systolic blood pressure x smoking status (ever vs never) interaction (2df test),	1.0E-7	rs2023843	upstream	3774	A Large-Scale Multi-ancestry Genome-wide Study Accounting for Smoking Behavior Identifies Multiple Significant Loci for Blood Pressure.
7:27243221	Systolic blood pressure x smoking status (current vs non-current) interaction (2df test),	4.0E-41	rs2023843	upstream	3774	A Large-Scale Multi-ancestry Genome-wide Study Accounting for Smoking Behavior Identifies Multiple Significant Loci for Blood Pressure.
7:27243221	Systolic blood pressure x smoking status (ever vs never) interaction (2df test),	3.0E-39	rs2023843	upstream	3774	A Large-Scale Multi-ancestry Genome-wide Study Accounting for Smoking Behavior Identifies Multiple Significant Loci for Blood Pressure.
7:27243221	Systolic blood pressure x smoking status (ever vs never) interaction (2df test),	3.0E-26	rs2023843	upstream	3774	A Large-Scale Multi-ancestry Genome-wide Study Accounting for Smoking Behavior Identifies Multiple Significant Loci for Blood Pressure.
7:27243221	Diastolic blood pressure x smoking status (ever vs never) interaction (2df test),	5.0E-32	rs2023843	upstream	3774	A Large-Scale Multi-ancestry Genome-wide Study Accounting for Smoking Behavior Identifies Multiple Significant Loci for Blood Pressure.
7:27243221	Diastolic blood pressure x smoking status (current vs non-current) interaction (2df test),	2.0E-6	rs2023843	upstream	3774	A Large-Scale Multi-ancestry Genome-wide Study Accounting for Smoking Behavior Identifies Multiple Significant Loci for Blood Pressure.
7:27243221	Diastolic blood pressure x smoking status (current vs non-current) interaction (2df test),	7.0E-22	rs2023843	upstream	3774	A Large-Scale Multi-ancestry Genome-wide Study Accounting for Smoking Behavior Identifies Multiple Significant Loci for Blood Pressure.
7:27243221	Diastolic blood pressure x smoking status (ever vs never) interaction (2df test),	6.0E-20	rs2023843	upstream	3774	A Large-Scale Multi-ancestry Genome-wide Study Accounting for Smoking Behavior Identifies Multiple Significant Loci for Blood Pressure.
7:27243221	Diastolic blood pressure x smoking status (ever vs never) interaction (2df test),	2.0E-7	rs2023843	upstream	3774	A Large-Scale Multi-ancestry Genome-wide Study Accounting for Smoking Behavior Identifies Multiple Significant Loci for Blood Pressure.
7:27243221	Systolic blood pressure,	3.0E-7	rs2023843	upstream	3774	Variant Discovery and Fine Mapping of Genetic Loci Associated with Blood Pressure Traits in Hispanics and African Americans.
7:27243221	Systolic blood pressure,	8.0E-41	rs2023843	upstream	3774	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
7:27243238	Urinary albumin-to-creatinine ratio,	2.0E-12	rs2023844	upstream	3791	Genome-wide association meta-analyses and fine-mapping elucidate pathways influencing albuminuria.
7:27243238	Urinary albumin excretion,	1.0E-9	rs2023844	upstream	3791	Genetic Association of Albuminuria with Cardiometabolic Disease and Blood Pressure.
7:27243238	Urinary albumin-to-creatinine ratio,	5.0E-12	rs2023844	upstream	3791	A genome-wide association study implicates multiple mechanisms influencing raised urinary albumin-creatinine ratio.
7:27243962	Diastolic blood pressure,	5.0E-11	rs4722675	upstream	4515	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27243962	Mean arterial pressure,	5.0E-13	rs4722675	upstream	4515	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27243962	Hypertension,	5.0E-10	rs4722675	upstream	4515	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27243962	Systolic blood pressure,	6.0E-12	rs4722675	upstream	4515	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27243962	Systolic blood pressure,	9.0E-11	rs4722675	upstream	4515	Genetic analysis of quantitative traits in the Japanese population links cell types to complex human diseases.
7:27243962	Medication use (calcium channel blockers),	1.0E-21	rs4722675	upstream	4515	A cross-population atlas of genetic associations for 220 human phenotypes.
7:27245101	Potassium levels,	3.0E-11	rs929250	upstream	5654	Genetic analysis of quantitative traits in the Japanese population links cell types to complex human diseases.
7:27245101	Medication use (agents acting on the renin-angiotensin system),	4.0E-19	rs929250	upstream	5654	A cross-population atlas of genetic associations for 220 human phenotypes.
7:27245893	Mean arterial pressure,	8.0E-13	rs3735533	upstream	6446	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27245893	Medication use (beta blocking agents),	3.0E-11	rs3735533	upstream	6446	Genome-wide association study of medication-use and associated disease in the UK Biobank.
7:27245893	Medication use (calcium channel blockers),	4.0E-20	rs3735533	upstream	6446	Genome-wide association study of medication-use and associated disease in the UK Biobank.
7:27245893	Medication use (agents acting on the renin-angiotensin system),	1.0E-17	rs3735533	upstream	6446	Genome-wide association study of medication-use and associated disease in the UK Biobank.
7:27245893	Diastolic blood pressure,	1.0E-11	rs3735533	upstream	6446	The genetics of blood pressure regulation and its target organs from association studies in 342,415 individuals.
7:27245893	Systolic blood pressure,	6.0E-14	rs3735533	upstream	6446	The genetics of blood pressure regulation and its target organs from association studies in 342,415 individuals.
7:27245893	Cardiovascular disease,	9.0E-17	rs3735533	upstream	6446	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
7:27245893	Medication use (beta blocking agents),	6.0E-12	rs3735533	upstream	6446	A cross-population atlas of genetic associations for 220 human phenotypes.
7:27245993	Pulse pressure,	7.0E-13	rs72125650	upstream	6546	A cross-population atlas of genetic associations for 220 human phenotypes.
7:27245994	Medication use (calcium channel blockers),	7.0E-10	rs879709947	upstream	6547	A cross-population atlas of genetic associations for 220 human phenotypes.
7:27245996	Systolic blood pressure,	7.0E-33	rs60772526	upstream	6549	Trans-ethnic association study of blood pressure determinants in over 750,000 individuals.
7:27245996	Systolic blood pressure,	4.0E-11	rs60772526	upstream	6549	A cross-population atlas of genetic associations for 220 human phenotypes.
7:27245996	Diastolic blood pressure,	3.0E-18	rs60772526	upstream	6549	A cross-population atlas of genetic associations for 220 human phenotypes.
7:27245996	Systolic blood pressure,	9.0E-25	rs60772526	upstream	6549	A cross-population atlas of genetic associations for 220 human phenotypes.
7:27245996	Mean arterial pressure,	2.0E-23	rs60772526	upstream	6549	A cross-population atlas of genetic associations for 220 human phenotypes.
7:27247279	Diastolic blood pressure,	4.0E-11	rs10228276	upstream	7832	Interethnic analyses of blood pressure loci in populations of East Asian and European descent.
7:27248891	Heel bone mineral density,	6.0E-25	rs7812039	upstream	9444	An atlas of genetic influences on osteoporosis in humans and mice.
7:27248891	Heel bone mineral density,	2.0E-13	rs7812039	upstream	9444	Identification of 613 new loci associated with heel bone mineral density and a polygenic risk score for bone mineral density, osteoporosis and fracture.
7:27248891	Diastolic blood pressure,	4.0E-10	rs7812039	upstream	9444	A cross-population atlas of genetic associations for 220 human phenotypes.
7:27248891	Mean arterial pressure,	4.0E-12	rs7812039	upstream	9444	A cross-population atlas of genetic associations for 220 human phenotypes.
7:27249617	Waist-hip ratio,	7.0E-14	rs17437657	upstream	10170	Meta-analysis of genome-wide association studies for body fat distribution in 694,649 individuals of European ancestry.
7:27249617	Waist-to-hip ratio adjusted for BMI,	2.0E-29	rs17437657	upstream	10170	Meta-analysis of genome-wide association studies for body fat distribution in 694,649 individuals of European ancestry.
7:27251776	Body mass index,	3.0E-7	rs10248288	upstream	12329	Genome-wide association study identifies 112 new loci for body mass index in the Japanese population.
7:27251776	Hip index,	8.0E-11	rs10248288	upstream	12329	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27251776	Waist-hip index,	3.0E-8	rs10248288	upstream	12329	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27251776	Waist-to-hip ratio adjusted for BMI,	3.0E-8	rs10248288	upstream	12329	GWAS of allometric body-shape indices in UK Biobank identifies loci suggesting associations with morphogenesis, organogenesis, adrenal cell renewal and cancer.
7:27264718	Waist circumference adjusted for body mass index,	7.0E-9	rs75584603	upstream	25271	Shared Genetic and Experimental Links between Obesity-Related Traits and Asthma Subtypes in UK Biobank.
7:27266509	Heel bone mineral density,	3.0E-10	rs149544731	upstream	27062	Leveraging Polygenic Functional Enrichment to Improve GWAS Power.
7:27279191	Conotruncal heart defects with normally related great vessels,	5.0E-6	rs3801321	upstream	39744	Genome-Wide Association Studies of Conotruncal Heart Defects with Normally Related Great Vessels in the United States.
7:27279846	Systolic blood pressure x alcohol consumption (light vs heavy) interaction (2df test),	3.0E-9	rs5883070	upstream	40399	Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
7:27279846	Mean arterial pressure x alcohol consumption (light vs heavy) interaction (2df test),	2.0E-9	rs5883070	upstream	40399	Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
7:27279846	Diastolic blood pressure x alcohol consumption (light vs heavy) interaction (2df test),	4.0E-8	rs5883070	upstream	40399	Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
7:27289117	Mean arterial pressure x alcohol consumption interaction (2df test),	4.0E-17	rs10255839	upstream	49670	Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
7:27289117	Systolic blood pressure x alcohol consumption (light vs heavy) interaction (2df test),	8.0E-13	rs10255839	upstream	49670	Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
7:27289117	Diastolic blood pressure x alcohol consumption interaction (2df test),	4.0E-19	rs10255839	upstream	49670	Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
7:27289117	Mean arterial pressure x alcohol consumption (light vs heavy) interaction (2df test),	1.0E-13	rs10255839	upstream	49670	Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
7:27289117	Diastolic blood pressure x alcohol consumption (light vs heavy) interaction (2df test),	4.0E-11	rs10255839	upstream	49670	Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.
7:27289117	Systolic blood pressure x alcohol consumption interaction (2df test),	9.0E-23	rs10255839	upstream	49670	Novel genetic associations for blood pressure identified via gene-alcohol interaction in up to 570K individuals across multiple ancestries.

Flanking region : 5 kb 10 kb 50 kb

Position	HGVS	dbSNP id	Phenotype List	Distance	Clinvar Significance
7:27194426	GRCh38/hg38 7p15.2(chr7:27154807-27422335)x1	NA	See cases	-45021	Pathogenic
7:27194426	GRCh38/hg38 7p15.2(chr7:27154807-27422335)x1	NA	See cases	-45021	Pathogenic
7:27198251	NM_000522.5(HOXA13):c.1114A>C (p.Asn372His)	rs121912542	Hand-foot-genital syndrome	-41196	Pathogenic
7:27198253	NM_000522.5(HOXA13):c.1112A>T (p.Gln371Leu)	NA	-	-41194	no interpretation for the single variant
7:27198258	NM_000522.5(HOXA13):c.1107G>A (p.Trp369Ter)	rs104894019	Hand-foot-genital syndrome	-41189	Pathogenic
7:27199671	NM_000522.5(HOXA13):c.355_406dup (p.Ser136fs)	rs387906542	Hand-foot-genital syndrome	-39776	Pathogenic
7:27199671	NM_000522.5(HOXA13):c.407C>A (p.Ser136Ter)	rs1158254994	Hand-foot-genital syndrome	-39776	Pathogenic
7:27203373	NM_152739.4(HOXA9):c.668A>C (p.Lys223Thr)	rs35991882	not provided	-36074	Uncertain significance
7:27203414	NM_152739.4(HOXA9):c.627G>A (p.Lys209=)	rs148367989	not provided	-36033	Benign
7:27213562	NM_018951.4(HOXA10):c.364C>T (p.Pro122Ser)	rs34720764	not provided	-25885	Benign
7:27213756	NM_018951.4(HOXA10):c.170A>G (p.Tyr57Cys)	NA	not specified	-25691	Uncertain significance
7:27222409	NM_005523.6(HOXA11):c.*6C>T	NA	not specified	-17038	Benign
7:27222485	NM_005523.6(HOXA11):c.872del (p.Asn291fs)	rs864321666	Radioulnar synostosis with amegakaryocytic thrombocytopenia 1	-16962	Pathogenic
7:27222485	NM_005523.6(HOXA11):c.872del (p.Asn291fs)	rs864321666	Radioulnar synostosis with amegakaryocytic thrombocytopenia 1	-16962	Pathogenic
7:27222517	NM_005523.6(HOXA11):c.840C>T (p.Leu280=)	rs115808703	not specified\|not provided	-16930	Benign/Likely benign
7:27223771	NM_005523.6(HOXA11):c.709+284G>A	NA	not provided	-15676	Benign
7:27224139	NM_005523.6(HOXA11):c.625G>A (p.Glu209Lys)	rs1085307723	not provided	-15308	Uncertain significance
7:27224275	NM_005523.6(HOXA11):c.489G>C (p.Lys163Asn)	NA	not specified	-15172	Benign
7:27224368	NM_005523.6(HOXA11):c.396G>C (p.Arg132Ser)	NA	Radioulnar synostosis with amegakaryocytic thrombocytopenia 1	-15079	Uncertain significance
7:27224411	NM_005523.6(HOXA11):c.353C>T (p.Pro118Leu)	NA	not provided	-15036	Uncertain significance
7:27224416	NM_005523.6(HOXA11):c.348C>G (p.His116Gln)	NA	not provided	-15031	Uncertain significance
7:27224432	NM_005523.6(HOXA11):c.332C>T (p.Ser111Leu)	NA	not provided	-15015	Uncertain significance
7:27224460	NM_005523.6(HOXA11):c.304G>A (p.Val102Met)	rs780070206	Flexion contracture	-14987	Uncertain significance
7:27224516	NM_005523.6(HOXA11):c.248A>G (p.Tyr83Cys)	rs778467438	Abnormal bleeding;Thrombocytopenia	-14931	Uncertain significance
7:27224612	NM_005523.6(HOXA11):c.152T>A (p.Leu51Gln)	NA	not provided	-14835	Uncertain significance
7:27224963	Single allele	NA	not provided	-14484	Benign
7:27237870	NM_000522.5(HOXA13):c.1114A>C (p.Asn372His)	rs121912542	Hand-foot-genital syndrome	-1577	Pathogenic
7:27237870	NM_000522.5(HOXA13):c.1114A>C (p.Asn372His)	rs121912542	Hand-foot-genital syndrome	-1577	Pathogenic
7:27237872	NM_000522.5(HOXA13):c.1112A>T (p.Gln371Leu)	NA	-	-1575	no interpretation for the single variant
7:27237872	NM_000522.5(HOXA13):c.1112A>T (p.Gln371Leu)	NA	-	-1575	no interpretation for the single variant
7:27237877	NM_000522.5(HOXA13):c.1107G>A (p.Trp369Ter)	rs104894019	Hand-foot-genital syndrome	-1570	Pathogenic
7:27237877	NM_000522.5(HOXA13):c.1107G>A (p.Trp369Ter)	rs104894019	Hand-foot-genital syndrome	-1570	Pathogenic
7:27237982	NM_000522.5(HOXA13):c.1002A>G (p.Leu334=)	rs35608915	not provided	-1465	Benign
7:27238022	NM_000522.5(HOXA13):c.962G>A (p.Arg321Lys)	NA	not provided	-1425	Uncertain significance
7:27238024	NM_000522.5(HOXA13):c.960G>C (p.Arg320Ser)	rs1190905313	not provided	-1423	Uncertain significance
7:27238691	NM_000522.5(HOXA13):c.922+84G>C	NA	not provided	-756	Benign
7:27238776	NM_000522.5(HOXA13):c.921C>G (p.Pro307=)	NA	not provided	-671	Uncertain significance
7:27238800	NM_000522.5(HOXA13):c.897C>T (p.Pro299=)	NA	not provided	-647	Benign
7:27239019	NM_000522.5(HOXA13):c.678G>A (p.Lys226=)	NA	not provided	-428	Likely benign
7:27239064	NM_000522.5(HOXA13):c.633G>T (p.Met211Ile)	rs35277569	not provided	-383	Benign/Likely benign
7:27239082	NM_000522.5(HOXA13):c.598GCC[4] (p.Ala204_Ala205del)	NA	not provided	-365	Uncertain significance
7:27239094	NM_000522.5(HOXA13):c.603C>T (p.Ala201=)	NA	not specified	-353	Uncertain significance
7:27239106	NM_000522.5(HOXA13):c.591C>A (p.Pro197=)	rs369862887	not provided	-341	Benign
7:27239122	NM_000522.5(HOXA13):c.575A>G (p.Lys192Arg)	rs528394833	not provided	-325	Likely benign
7:27239136	NM_000522.5(HOXA13):c.561C>T (p.His187=)	rs1226159920	not provided	-311	Likely benign
7:27239170	NM_000522.5(HOXA13):c.527G>A (p.Ser176Asn)	NA	not provided	-277	Uncertain significance
7:27239193	NM_000522.5(HOXA13):c.504G>A (p.Ala168=)	NA	not provided	-254	Benign
7:27239198	NM_000522.5(HOXA13):c.499G>T (p.Ala167Ser)	NA	not provided	-249	Uncertain significance
7:27239201	NM_000522.5(HOXA13):c.496C>A (p.Pro166Thr)	NA	not provided	-246	Benign
7:27239216	NM_000522.5(HOXA13):c.481C>T (p.Gln161Ter)	NA	not provided	-231	Uncertain significance
7:27239217	NM_000522.5(HOXA13):c.480G>A (p.Ala160=)	rs537218194	not provided\|not specified	-230	Benign
7:27239241	NM_000522.5(HOXA13):c.456A>G (p.Gln152=)	NA	not provided	-206	Likely benign
7:27239266	NM_000522.5(HOXA13):c.431C>T (p.Pro144Leu)	NA	not provided	-181	Uncertain significance
7:27239275	NM_000522.5(HOXA13):c.421_422insAGGCGGGCC (p.Gly140_Pro141insGlnAlaGly)	rs35599078	not provided	-172	Uncertain significance
7:27239290	NM_000522.5(HOXA13):c.355_406dup (p.Ser136fs)	rs387906542	Hand-foot-genital syndrome	-157	Pathogenic
7:27239290	NM_000522.5(HOXA13):c.407C>A (p.Ser136Ter)	rs1158254994	Hand-foot-genital syndrome	-157	Pathogenic
7:27239290	NM_000522.5(HOXA13):c.407C>A (p.Ser136Ter)	rs1158254994	Hand-foot-genital syndrome	-157	Pathogenic
7:27239290	NM_000522.5(HOXA13):c.355_406dup (p.Ser136fs)	rs387906542	Hand-foot-genital syndrome	-157	Pathogenic
7:27239299	NM_000522.5(HOXA13):c.381CGC[5] (p.Ala133del)	NA	not specified	-148	Benign
7:27239302	NM_000522.5(HOXA13):c.357_395del (p.Ala121_Ala133del)	rs1428793938	not provided	-145	Uncertain significance
7:27239305	NM_000522.5(HOXA13):c.357_392del (p.Ala122_Ala133del)	rs1235002831	not provided	-142	Uncertain significance
7:27239308	NM_000522.5(HOXA13):c.357_389del (p.Ala123_Ala133del)	NA	not provided	-139	Uncertain significance
7:27239311	NM_000522.5(HOXA13):c.357_386del (p.Ala124_Ala133del)	rs34856009	not provided	-136	Likely benign
7:27239319	NM_000522.5(HOXA13):c.360_377dup (p.Ala128_Ala133dup)	NA	Hand-foot-genital syndrome	-128	Likely pathogenic
7:27239320	NM_000522.5(HOXA13):c.351_377del (p.Ala125_Ala133del)	rs1195806602	not provided	-127	Uncertain significance
7:27239320	NM_000522.5(HOXA13):c.360_377del (p.Ala128_Ala133del)	rs35861510	not provided	-127	Likely benign
7:27239324	NM_000522.5(HOXA13):c.373G>A (p.Ala125Thr)	NA	not provided	-123	Uncertain significance
7:27239331	NM_000522.5(HOXA13):c.366G>T (p.Ala122=)	rs769255866	not provided	-116	Likely benign
7:27239340	NM_000522.5(HOXA13):c.357T>C (p.Ala119=)	rs916730569	not provided	-107	Likely benign
7:27239355	NM_000522.5(HOXA13):c.342G>A (p.Pro114=)	rs868161182	not provided	-92	Likely benign
7:27239417	NM_000522.5(HOXA13):c.280C>G (p.Pro94Ala)	NA	not provided	-30	Uncertain significance
7:27239434	NM_000522.5(HOXA13):c.263G>A (p.Arg88His)	NA	not provided	-13	Uncertain significance
7:27239463	NM_000522.5(HOXA13):c.234T>A (p.Ala78=)	rs1308135144	not provided	16	Likely benign
7:27239522	NM_000522.5(HOXA13):c.175C>T (p.Pro59Ser)	NA	not provided	75	Uncertain significance
7:27239522	NM_000522.5(HOXA13):c.175C>G (p.Pro59Ala)	NA	not provided	75	Likely benign
7:27239538	NM_000522.5(HOXA13):c.159C>G (p.Ala53=)	rs1362954246	not specified	91	Likely benign
7:27239545	NM_000522.5(HOXA13):c.126_152del (p.Ala43_Ala51del)	NA	not provided	98	Likely benign
7:27239547	NM_000522.5(HOXA13):c.150T>G (p.Ala50=)	rs1554275930	not specified	100	Likely benign
7:27239550	NM_000522.5(HOXA13):c.147G>A (p.Ala49=)	NA	not provided	103	Benign
7:27239557	NM_000522.5(HOXA13):c.140C>T (p.Ala47Val)	NA	not provided	110	Uncertain significance
7:27239651	NM_000522.5(HOXA13):c.46G>A (p.Val16Ile)	NA	not provided	204	Uncertain significance
7:27239672	NM_000522.5(HOXA13):c.25C>T (p.Pro9Ser)	NA	not provided	225	Likely benign
7:27239774	NG_008181.2:g.4951_4952del	NA	-	327	no interpretation for the single variant
7:27240015	Single allele	NA	not provided	568	Benign
7:27285690	NM_001989.5(EVX1):c.870A>C (p.Ala290=)	rs114407231	not provided	46243	Benign

Position	Population	BlockLength (kb)	Distance	Location with respect to STR	No. of SNPs	SNPs in the Haploblock
7:27189982-27190358	all_pop	0.377	-49465	downstream	3	rs3735530, rs17472063, rs1747207,
7:27190398-27190670	all_pop	0.273	-49049	downstream	2	rs11762730, rs88633,
7:27191804-27194096	all_pop	2.293	-47643	downstream	2	rs62454420, rs1750093,
7:27196113-27198860	all_pop	2.748	-43334	downstream	10	rs2301721, rs71539503, rs10238095, rs73290321, rs4722665, rs4722666, rs985652, rs17437411, rs73290322, rs1024671,
7:27200855-27201532	all_pop	0.678	-38592	downstream	4	rs875897, rs875898, rs12530948, rs87589,
7:27201258-27204239	AFR	2.982	-38189	downstream	6	rs12530948, rs875896, rs10259620, rs7810502, rs17500987, rs1747214,
7:27202289-27203139	all_pop	0.851	-37158	downstream	2	rs10259620, rs781050,
7:27202289-27203139	EUR	0.851	-37158	downstream	2	rs10259620, rs781050,
7:27202289-27203139	SAS	0.851	-37158	downstream	2	rs10259620, rs781050,
7:27203185-27205282	all_pop	2.098	-36262	downstream	4	rs17500987, rs17472147, rs35355140, rs380177,
7:27204732-27205282	AMR	0.551	-34715	downstream	2	rs35355140, rs380177,
7:27204732-27205282	EUR	0.551	-34715	downstream	2	rs35355140, rs380177,
7:27206467-27206688	AFR	0.222	-32980	downstream	2	rs6461991, rs1177380,
7:27206467-27206688	all_pop	0.222	-32980	downstream	2	rs6461991, rs1177380,
7:27206467-27206688	AMR	0.222	-32980	downstream	2	rs6461991, rs1177380,
7:27206467-27218468	EAS	12.002	-32980	downstream	16	rs6461991, rs11773804, rs886340, rs2237336, rs2071243, rs12532649, rs36075045, rs34311813, rs3779456, rs6949451, rs17449226, rs6970537, rs7806799, rs1859163, rs1859164, rs185916,
7:27206467-27218468	EUR	12.002	-32980	downstream	15	rs6461991, rs11773804, rs886340, rs2237336, rs2071243, rs117827196, rs36075045, rs34311813, rs3779456, rs6949451, rs6970537, rs7806799, rs1859163, rs1859164, rs185916,
7:27206467-27207501	SAS	1.035	-32980	downstream	3	rs6461991, rs11773804, rs88634,
7:27207463-27218468	all_pop	11.006	-31984	downstream	15	rs17472189, rs886340, rs2237336, rs2071243, rs111242660, rs17472203, rs36075045, rs34311813, rs3779456, rs6949451, rs6970537, rs7806799, rs1859163, rs1859164, rs185916,
7:27207501-27218468	AMR	10.968	-31946	downstream	13	rs886340, rs2237336, rs2071243, rs36075045, rs34311813, rs3779456, rs6949451, rs4722668, rs6970537, rs7806799, rs1859163, rs1859164, rs185916,
7:27207585-27218419	SAS	10.835	-31862	downstream	12	rs17437439, rs2237336, rs2071243, rs36075045, rs34311813, rs373417573, rs3779456, rs6949451, rs6970537, rs7806799, rs1859163, rs185916,
7:27207714-27210428	AFR	2.715	-31733	downstream	7	rs17501035, rs2237336, rs2071243, rs192915053, rs111242660, rs17472203, rs3607504,
7:27214557-27218468	AFR	3.912	-24890	downstream	6	rs3779456, rs6949451, rs6970537, rs7806799, rs1859164, rs185916,
7:27220787-27221065	AFR	0.279	-18660	downstream	5	rs201060089, rs199820715, rs530375207, rs79891240, rs383713,
7:27220787-27223771	all_pop	2.985	-18660	downstream	8	rs201060089, rs199820715, rs530375207, rs6461992, rs3837134, rs17501111, rs6968828, rs780158,
7:27220787-27223082	AMR	2.296	-18660	downstream	7	rs201060089, rs199820715, rs530375207, rs6461992, rs3837134, rs148548092, rs1750111,
7:27220787-27221065	EUR	0.279	-18660	downstream	5	rs201060089, rs199820715, rs530375207, rs6461992, rs383713,
7:27221065-27238691	EAS	17.627	-18382	downstream	16	rs3837134, rs6968828, rs2285724, rs141075420, rs3214167, rs916880, rs4722670, rs4722671, rs6461995, rs4722672, rs9770544, rs60250869, rs2391397, rs115525024, rs757181, rs207126,
7:27221065-27236557	SAS	15.493	-18382	downstream	15	rs3837134, rs6968828, rs7801581, rs17427875, rs2285724, rs79658629, rs3214167, rs916880, rs4722670, rs4722671, rs6461995, rs376442406, rs4722672, rs9770544, rs6025086,
7:27221331-27223771	AFR	2.441	-18116	downstream	5	rs17501084, rs17501090, rs17501111, rs6968828, rs780158,
7:27223082-27240482	EUR	17.401	-16365	downstream	25	rs17501111, rs6968828, rs7801581, rs17437495, rs17427875, rs4722669, rs2285724, rs79658629, rs3214167, rs113250176, rs916880, rs4722670, rs4722671, rs6461995, rs4722672, rs9770544, rs148397727, rs11984297, rs60250869, rs2391397, rs115525024, rs757181, rs2189239, rs2071265, rs380759,
7:27223563-27240482	AMR	16.92	-15884	downstream	22	rs6968828, rs7801581, rs17437495, rs17427875, rs4722669, rs2285724, rs79658629, rs3214167, rs916880, rs4722670, rs4722671, rs6461995, rs4722672, rs9770544, rs148397727, rs60250869, rs2391397, rs115525024, rs757181, rs2189239, rs2071265, rs380759,
7:27225558-27236557	all_pop	11	-13889	downstream	11	rs17427875, rs2285724, rs3214167, rs916880, rs4722670, rs4722671, rs6461995, rs4722672, rs9770544, rs148397727, rs6025086,
7:27226784-27236958	AFR	10.175	-12663	downstream	23	rs17472280, rs2285724, rs17472294, rs3214167, rs4722670, rs17472329, rs17501181, rs4722671, rs10264133, rs6461995, rs114957123, rs4722672, rs9770544, rs148397727, rs116834446, rs17501209, rs17501215, rs17472371, rs17501250, rs34483842, rs17501278, rs2391397, rs75718,
7:27236559-27240482	all_pop	3.924	-2888	downstream	5	rs115525024, rs757181, rs2189239, rs2071265, rs380759,
7:27236559-27242359	SAS	5.801	-2888	downstream	8	rs115525024, rs757181, rs2071265, rs3807598, rs17501292, rs2067087, rs5883064, rs185916,
7:27240482-27241660	EAS	1.179	1035	upstream	3	rs3807598, rs17501292, rs206708,
7:27241660-27242359	EUR	0.7	2213	upstream	3	rs2067087, rs5883064, rs185916,
7:27241878-27242466	all_pop	0.589	2431	upstream	3	rs5883064, rs1859168, rs1742796,
7:27241878-27242617	AMR	0.74	2431	upstream	4	rs5883064, rs1859168, rs17427960, rs224004,
7:27241878-27245994	EAS	4.117	2431	upstream	13	rs5883064, rs1859168, rs17427960, rs2240042, rs10233387, rs2023843, rs2023844, rs4722675, rs144116338, rs929250, rs3735533, rs72125650, rs7824803,
7:27242617-27245893	all_pop	3.277	3170	upstream	8	rs2240042, rs10233387, rs2023843, rs2023844, rs4722675, rs144116338, rs929250, rs373553,
7:27242617-27248891	EUR	6.275	3170	upstream	15	rs2240042, rs10233387, rs2023843, rs2023844, rs4722675, rs144116338, rs929250, rs3735533, rs72125650, rs78248039, rs60772526, rs61056117, rs10228276, rs13243033, rs781203,
7:27242617-27248891	SAS	6.275	3170	upstream	15	rs2240042, rs10233387, rs2023843, rs2023844, rs4722675, rs144116338, rs929250, rs3735533, rs72125650, rs78248039, rs60772526, rs61056117, rs10228276, rs13243033, rs781203,
7:27243106-27248891	AMR	5.786	3659	upstream	16	rs10233387, rs2023843, rs2023844, rs4722675, rs144116338, rs190973809, rs929250, rs142718525, rs3735533, rs72125650, rs78248039, rs60772526, rs61056117, rs10228276, rs13243033, rs781203,
7:27243141-27244096	AFR	0.956	3694	upstream	3	rs17472483, rs2023843, rs1750132,
7:27245992-27245997	AFR	0.006	6545	upstream	4	rs72125650, rs78248039, rs60772526, rs6105611,
7:27245992-27245997	all_pop	0.006	6545	upstream	4	rs72125650, rs78248039, rs60772526, rs6105611,
7:27245996-27258359	EAS	12.364	6549	upstream	12	rs60772526, rs61056117, rs10228276, rs13243033, rs7812039, rs10248288, rs6958837, rs6951104, rs4722677, rs10264581, rs10262140, rs14667471,
7:27247377-27251396	AFR	4.02	7930	upstream	14	rs17501340, rs17472490, rs13243033, rs17501347, rs17501361, rs17501368, rs7812039, rs11973735, rs17501375, rs17501382, rs17501389, rs17428012, rs7786570, rs1742802,
7:27248373-27250377	all_pop	2.005	8926	upstream	4	rs13243033, rs7812039, rs11973735, rs1742801,
7:27249147-27250377	AMR	1.231	9700	upstream	3	rs11973735, rs17437657, rs1742801,
7:27249147-27250377	EUR	1.231	9700	upstream	3	rs11973735, rs17437657, rs1742801,
7:27251396-27252246	all_pop	0.851	11949	upstream	3	rs17428025, rs10248288, rs695883,
7:27251549-27252767	AFR	1.219	12102	upstream	3	rs17501431, rs6958837, rs1747258,
7:27251776-27267341	AMR	15.566	12329	upstream	16	rs10248288, rs6958837, rs17437677, rs6951104, rs28357166, rs4722677, rs10264581, rs80306758, rs10262140, rs17472630, rs12666259, rs10486494, rs6951180, rs6951363, rs17428109, rs696489,
7:27251776-27255650	EUR	3.875	12329	upstream	8	rs10248288, rs6958837, rs17437670, rs113189091, rs6951104, rs4722677, rs10264581, rs8030675,
7:27251776-27252246	SAS	0.471	12329	upstream	2	rs10248288, rs695883,
7:27253795-27253966	AFR	0.172	14348	upstream	2	rs6951104, rs54479014,
7:27253795-27256464	all_pop	2.67	14348	upstream	5	rs6951104, rs4722677, rs10264581, rs17428046, rs1026214,
7:27253795-27271127	SAS	17.333	14348	upstream	11	rs6951104, rs4722677, rs10264581, rs10262140, rs12666259, rs10486494, rs6951180, rs17428109, rs6964896, rs12700794, rs1322182,
7:27254725-27259161	AFR	4.437	15278	upstream	21	rs6974420, rs17472609, rs28483477, rs17472623, rs17428046, rs17501475, rs531233227, rs17501482, rs551298831, rs17472630, rs17472644, rs73291911, rs77240644, rs17472651, rs59935254, rs66955054, rs6967669, rs59133852, rs60356285, rs6968095, rs696784,
7:27256464-27293087	EUR	36.624	17017	upstream	53	rs10262140, rs12666259, rs10486494, rs17428074, rs6951180, rs11975202, rs6951363, rs11983008, rs11983027, rs17428116, rs11971150, rs6964896, rs6461996, rs17472756, rs12700794, rs80116417, rs17472763, rs111694105, rs111823712, rs13221828, rs113798742, rs368710565, rs112406562, rs113546013, rs113155788, rs11425126, rs6948488, rs17472892, rs12700795, rs17437775, rs757179, rs5883067, rs2391400, rs5883068, rs12700796, rs6461997, rs144734005, rs3801321, rs5883070, rs757180, rs17428157, rs6461998, rs17472962, rs6461999, rs11980022, rs2074399, rs76744817, rs17437824, rs6956598, rs11977099, rs2214412, rs56029757, rs239140,
7:27258897-27259037	all_pop	0.141	19450	upstream	2	rs66955054, rs696766,
7:27259042-27259075	all_pop	0.034	19595	upstream	2	rs59133852, rs6035628,
7:27259142-27260775	all_pop	1.634	19695	upstream	6	rs6968095, rs6967840, rs12666259, rs11564053, rs60803002, rs1048649,
7:27260775-27294701	EAS	33.927	21328	upstream	36	rs10486494, rs6951180, rs17428109, rs6964896, rs147100128, rs149859450, rs147995548, rs13221828, rs368710565, rs2158216, rs11425126, rs6973893, rs12700795, rs757179, rs5883067, rs2391400, rs5883068, rs12700796, rs6461997, rs3801321, rs5883070, rs757180, rs17478154, rs6461998, rs6461999, rs2074399, rs6956598, rs2214412, rs10255839, rs17437838, rs4722678, rs17437859, rs2391402, rs17428220, rs11370147, rs779419,
7:27262065-27270132	AFR	8.068	22618	upstream	23	rs17428074, rs143305892, rs6951180, rs11975202, rs6951363, rs11983008, rs6956721, rs11983027, rs17501559, rs11971150, rs17501580, rs11563587, rs17472728, rs17472742, rs6964896, rs6461996, rs17472756, rs17472763, rs17472770, rs10235918, rs11564048, rs17501628, rs1750163,
7:27262849-27263903	all_pop	1.055	23402	upstream	4	rs6951180, rs11975202, rs6951363, rs1198300,
7:27264178-27268848	all_pop	4.671	24731	upstream	7	rs11983027, rs17428109, rs11971150, rs6964896, rs6461996, rs17472756, rs1270079,
7:27270312-27270698	AFR	0.387	30865	upstream	3	rs536101159, rs111694105, rs11182371,
7:27271127-27271264	AFR	0.138	31680	upstream	3	rs13221828, rs151254831, rs11379874,
7:27271127-27273866	AMR	2.74	31680	upstream	3	rs13221828, rs368710565, rs215821,
7:27271501-27273866	SAS	2.366	32054	upstream	2	rs368710565, rs215821,
7:27271653-27273827	AFR	2.175	32206	upstream	6	rs112406562, rs113546013, rs58045581, rs10233548, rs10215610, rs696368,
7:27273827-27273866	all_pop	0.04	34380	upstream	2	rs6963685, rs215821,
7:27274187-27274312	AFR	0.126	34740	upstream	2	rs57330666, rs1142512,
7:27274634-27279191	all_pop	4.558	35187	upstream	13	rs6948488, rs6973893, rs17472892, rs12700795, rs17437775, rs757179, rs5883067, rs2391400, rs5883068, rs12700796, rs6461997, rs144734005, rs380132,
7:27275555-27289117	AMR	13.563	36108	upstream	22	rs6973893, rs12700795, rs148931458, rs757179, rs5883067, rs2391400, rs5883068, rs12700796, rs6461997, rs3801321, rs5883070, rs757180, rs886338, rs6461998, rs6461999, rs11980022, rs2074399, rs17437824, rs17428185, rs6956598, rs2214412, rs1025583,
7:27275555-27288041	SAS	12.487	36108	upstream	16	rs6973893, rs12700795, rs757179, rs5883067, rs2391400, rs5883068, rs12700796, rs6461997, rs3801321, rs5883070, rs757180, rs6461998, rs6461999, rs2074399, rs6956598, rs221441,
7:27275696-27279633	AFR	3.938	36249	upstream	13	rs10215423, rs17501739, rs17437775, rs17472899, rs77559391, rs17472906, rs17472913, rs12700796, rs17501759, rs6980012, rs144734005, rs3801321, rs1023959,
7:27279845-27288149	AFR	8.305	40398	upstream	31	rs5883070, rs757180, rs59007191, rs6461998, rs17501801, rs17472962, rs6461999, rs17472976, rs11980022, rs149823344, rs144213307, rs2074399, rs76744817, rs17437824, rs17501822, rs17501829, rs17472997, rs17473004, rs17501843, rs75185414, rs113936209, rs114407231, rs6956598, rs17473032, rs148530202, rs17501878, rs11977099, rs17473046, rs17473053, rs2214412, rs1747306,
7:27279977-27281157	all_pop	1.181	40530	upstream	3	rs757180, rs59007191, rs646199,
7:27281304-27289117	all_pop	7.814	41857	upstream	9	rs6461999, rs11980022, rs2074399, rs76744817, rs17437824, rs6956598, rs11977099, rs2214412, rs1025583,
7:27289117-27289410	AFR	0.294	49670	upstream	2	rs10255839, rs1750189,

No Alu found near the repeat

Conservation score was not calculated