STRIDE-DB

Repeat Length	AFR	AMR	EUR	EAS	SAS	Repeat
10.2	6	0	0	0	0	CCCCGCCCCGGGCCCGCCCCCGGGCCCGCCCCGACCACGCCCCGGCCCCGGCCCCGGCCCC
9.0	0	0	0	0	1	CCCCGCCCCGGGCCCGCCCCCGGGCCCGCCCCGACCACGCCCCGGCCCCGGCCC
9.2	36	18	38	30	40	CCCCGCCCCGGGCCCGCCCCCGGGCCCGCCCCGACCACGCCCCGGCCCCGGCCCC
11.2	0	2	0	0	6	CCCCGCCCCGGGCCCGCCCCCGGGCCCGCCCCGACCACGCCCCGGCCCCGGCCCCGGCCCCCCCGCC
12.2	0	0	4	0	5	CCCCGCCCCGGGCCCGCCCCCGGGCCCGCCCCGACCACGCCCCGGCCCCGGCCCCGGCCCCCCCGCCCCCGCC

Position	Disease/Trait	P-value	SNPs	Location with respect to STR	distance	Study
9:27533452	Educational attainment,	1.0E-7	rs4879541	downstream	-40032	Polygenic prediction of educational attainment within and between families from genome-wide association analyses in 3 million individuals.
9:27533984	Heart failure,	5.0E-6	rs10812610	downstream	-39500	Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium.
9:27536397	Amyotrophic lateral sclerosis,	7.0E-9	rs2814707	downstream	-37087	Genome-wide association study identifies 19p13.3 (UNC13A) and 9p21.2 as susceptibility loci for sporadic amyotrophic lateral sclerosis.
9:27543281	Amyotrophic lateral sclerosis,	2.0E-6	rs3849942	downstream	-30203	Exome array analysis of rare and low frequency variants in amyotrophic lateral sclerosis.
9:27543281	Amyotrophic lateral sclerosis,	4.0E-7	rs3849942	downstream	-30203	Age of onset of amyotrophic lateral sclerosis is modulated by a locus on 1p34.1.
9:27543281	Amyotrophic lateral sclerosis,	1.0E-8	rs3849942	downstream	-30203	Genome-wide association study identifies 19p13.3 (UNC13A) and 9p21.2 as susceptibility loci for sporadic amyotrophic lateral sclerosis.
9:27543281	Amyotrophic lateral sclerosis,	9.0E-11	rs3849942	downstream	-30203	Chromosome 9p21 in amyotrophic lateral sclerosis in Finland: a genome-wide association study.
9:27543281	Amyotrophic lateral sclerosis (sporadic),	1.0E-8	rs3849942	downstream	-30203	A genome-wide association meta-analysis identifies a novel locus at 17q11.2 associated with sporadic amyotrophic lateral sclerosis.
9:27543382	Amyotrophic lateral sclerosis,	4.0E-30	rs3849943	downstream	-30102	Genome-wide Analyses Identify KIF5A as a Novel ALS Gene.
9:27543382	Amyotrophic lateral sclerosis (sporadic),	3.0E-23	rs3849943	downstream	-30102	Cross-ethnic meta-analysis identifies association of the GPX3-TNIP1 locus with amyotrophic lateral sclerosis.
9:27543382	Amyotrophic lateral sclerosis,	6.0E-10	rs3849943	downstream	-30102	C9orf72 and UNC13A are shared risk loci for amyotrophic lateral sclerosis and frontotemporal dementia: a genome-wide meta-analysis.
9:27543382	Amyotrophic lateral sclerosis,	4.0E-19	rs3849943	downstream	-30102	Genome-wide association analyses identify new risk variants and the genetic architecture of amyotrophic lateral sclerosis.
9:27561049	Amyotrophic lateral sclerosis,	3.0E-6	rs774359	downstream	-12435	Genome-wide association study identifies 19p13.3 (UNC13A) and 9p21.2 as susceptibility loci for sporadic amyotrophic lateral sclerosis.
9:27565936	Cathepsin L1 levels,	4.0E-25	rs1031153	downstream	-7548	Genomic and drug target evaluation of 90 cardiovascular proteins in 30,931 individuals.
9:27607973	Frontotemporal dementia,	6.0E-11	rs117204439	upstream	34489	Genome-wide association study of frontotemporal dementia identifies a C9ORF72 haplotype with a median of 12-G4C2 repeats that predisposes to pathological repeat expansions.
9:27610657	PCA3 expression level,	2.0E-7	rs2889829	upstream	37173	Genome-wide association study identifies genetic determinants of urine PCA3 levels in men.

Flanking region : 5 kb 10 kb 50 kb

Position	HGVS	dbSNP id	Phenotype List	Distance	Clinvar Significance
9:27526480	GRCh37/hg19 9p21.2(chr9:27526480-27670083)x3	NA	not provided	-47004	Benign
9:27546608	NM_018325.5(C9orf72):c.*1626G>A	rs1820774330	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-26876	Uncertain significance
9:27546686	NM_018325.5(C9orf72):c.*1548G>A	rs549660498	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-26798	Uncertain significance
9:27546765	NM_018325.5(C9orf72):c.*1469T>A	rs141012074	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-26719	Benign
9:27546828	NM_018325.5(C9orf72):c.*1406T>C	rs9103	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-26656	Benign
9:27546890	NM_018325.5(C9orf72):c.*1344C>T	rs13691	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-26594	Benign
9:27546972	NM_018325.5(C9orf72):c.*1262A>C	rs886063833	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	-26512	Uncertain significance
9:27547020	NM_018325.5(C9orf72):c.*1214T>C	rs191690136	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-26464	Likely benign
9:27547098	NM_018325.5(C9orf72):c.*1136T>C	rs375528640	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-26386	Uncertain significance
9:27547170	NM_018325.5(C9orf72):c.*1064A>G	rs184151041	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-26314	Uncertain significance
9:27547176	NM_018325.5(C9orf72):c.*1058G>T	rs41272887	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-26308	Benign
9:27547210	NM_018325.5(C9orf72):c.*1024A>G	rs563194682	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-26274	Benign
9:27547313	NM_018325.5(C9orf72):c.*921C>A	rs3739526	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-26171	Benign
9:27547320	NM_018325.5(C9orf72):c.*914A>G	rs561651779	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-26164	Benign
9:27547333	NM_018325.5(C9orf72):c.*901T>C	rs774314112	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-26151	Uncertain significance
9:27547343	NM_018325.5(C9orf72):c.*891A>G	rs952713285	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-26141	Uncertain significance
9:27547397	NM_018325.5(C9orf72):c.*837G>A	rs80172172	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-26087	Benign
9:27547437	NM_018325.5(C9orf72):c.794_797del	rs886063834	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	-26047	Uncertain significance
9:27547447	NM_018325.5(C9orf72):c.*787G>A	rs148832592	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-26037	Uncertain significance
9:27547561	NM_018325.5(C9orf72):c.*673T>C	rs886063835	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25923	Uncertain significance
9:27547583	NM_018325.5(C9orf72):c.*651G>T	rs548883941	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25901	Benign
9:27547632	NM_018325.5(C9orf72):c.*602A>G	rs567258799	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25852	Uncertain significance
9:27547657	NM_018325.5(C9orf72):c.*577G>C	rs886063836	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25827	Uncertain significance
9:27547682	NM_018325.5(C9orf72):c.*552A>C	rs886063837	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25802	Uncertain significance
9:27547780	NM_018325.5(C9orf72):c.*454A>G	rs754824201	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25704	Uncertain significance
9:27547878	NM_018325.5(C9orf72):c.*356T>G	rs886063838	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25606	Uncertain significance
9:27547917	NM_018325.5(C9orf72):c.*317A>G	rs886063839	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25567	Uncertain significance
9:27547924	NM_018325.5(C9orf72):c.*309dup	rs200583482	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	-25560	Likely benign
9:27547984	NM_018325.5(C9orf72):c.*250T>C	rs886063840	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25500	Uncertain significance
9:27547986	NM_018325.5(C9orf72):c.*248T>C	rs73440933	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25498	Benign
9:27548010	NM_018325.5(C9orf72):c.*224C>G	rs1333786274	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25474	Uncertain significance
9:27548060	NM_018325.5(C9orf72):c.*174C>T	rs146530591	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25424	Benign
9:27548090	NM_018325.5(C9orf72):c.*144C>T	rs1820806932	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25394	Uncertain significance
9:27548112	NM_018325.5(C9orf72):c.*122G>A	rs549202876	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25372	Uncertain significance
9:27548161	NM_018325.5(C9orf72):c.*73G>A	rs886063841	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25323	Uncertain significance
9:27548202	NM_018325.5(C9orf72):c.*32A>C	rs759595881	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25282	Uncertain significance
9:27548254	NM_018325.5(C9orf72):c.1426G>C (p.Asp476His)	rs767272170	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25230	Uncertain significance
9:27548256	NM_018325.5(C9orf72):c.1424G>A (p.Arg475Gln)	rs750045383	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25228	Uncertain significance
9:27548276	NM_018325.5(C9orf72):c.1404C>T (p.Phe468=)	rs141063383	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1\|not provided	-25208	Benign
9:27548293	NM_018325.5(C9orf72):c.1387A>G (p.Ile463Val)	rs747372712	not provided	-25191	Uncertain significance
9:27548395	NM_018325.5(C9orf72):c.1285T>C (p.Ser429Pro)	rs200703028	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-25089	Uncertain significance
9:27548431	NM_018325.5(C9orf72):c.1260-12dup	rs749166700	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	-25053	Uncertain significance
9:27548431	NM_018325.5(C9orf72):c.1260-12_1260-11insT	rs1554659312	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	-25053	Uncertain significance
9:27548432	NM_018325.5(C9orf72):c.1260-13_1260-12insT	rs772249544	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	-25052	Uncertain significance
9:27548432	NM_018325.5(C9orf72):c.1260-13_1260-12insTT	rs772249544	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	-25052	Uncertain significance
9:27548432	NM_018325.5(C9orf72):c.1260-16_1260-13dup	rs1554659316	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	-25052	Uncertain significance
9:27548433	NM_018325.5(C9orf72):c.1260-14_1260-13del	rs886063842	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	-25051	Uncertain significance
9:27548433	NM_018325.5(C9orf72):c.1260-15_1260-13del	rs886063843	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	-25051	Uncertain significance
9:27548433	NM_018325.5(C9orf72):c.1260-16_1260-14dup	rs11292923	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	-25051	Uncertain significance
9:27548433	NM_018325.5(C9orf72):c.1260-18_1260-14dup	rs11292923	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	-25051	Uncertain significance
9:27548433	NM_018325.5(C9orf72):c.1260-14dup	rs11292923	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	-25051	Uncertain significance
9:27548433	NM_018325.5(C9orf72):c.1260-17_1260-14dup	rs11292923	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	-25051	Uncertain significance
9:27548434	NM_018325.5(C9orf72):c.1260-14del	rs11292923	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	-25050	Uncertain significance
9:27548434	NM_018325.5(C9orf72):c.1260-16_1260-14del	rs11292923	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	-25050	Benign
9:27548547	NM_018325.5(C9orf72):c.1259+8A>C	rs182259442	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-24937	Likely benign
9:27548576	NM_018325.5(C9orf72):c.1238T>C (p.Ile413Thr)	rs760887239	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-24908	Uncertain significance
9:27548604	NM_018325.5(C9orf72):c.1210G>T (p.Val404Phe)	rs541965231	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-24880	Uncertain significance
9:27550639	NM_018325.5(C9orf72):c.1149+9T>C	rs139352974	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1\|not provided	-22845	Benign
9:27556599	NM_018325.5(C9orf72):c.1051G>T (p.Asp351Tyr)	rs1307772456	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-16885	Uncertain significance
9:27556648	NM_018325.5(C9orf72):c.1002C>T (p.Ser334=)	rs780494226	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-16836	Uncertain significance
9:27556656	NM_018325.5(C9orf72):c.994A>T (p.Met332Leu)	rs146043466	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-16828	Uncertain significance
9:27556665	NM_018325.5(C9orf72):c.985C>T (p.Arg329Cys)	rs773251849	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-16819	Uncertain significance
9:27556780	NM_018325.5(C9orf72):c.870C>T (p.Ser290=)	rs10122902	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1\|not specified	-16704	Benign
9:27558552	NM_018325.5(C9orf72):c.792G>T (p.Arg264Ser)	rs886063845	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	-14932	Uncertain significance
9:27558573	NM_018325.5(C9orf72):c.771A>G (p.Pro257=)	rs1169081203	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-14911	Uncertain significance
9:27558579	NM_018325.5(C9orf72):c.765G>A (p.Leu255=)	rs758724401	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-14905	Uncertain significance
9:27560260	NM_018325.5(C9orf72):c.703G>A (p.Val235Ile)	rs781214485	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-13224	Likely benign
9:27560281	NM_018325.5(C9orf72):c.682T>C (p.Leu228=)	rs147034723	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-13203	Benign
9:27561465	NM_018325.5(C9orf72):c.665+115_665+117dup	NA	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-12019	Benign
9:27561628	NM_018325.5(C9orf72):c.620A>G (p.Asn207Ser)	rs17769294	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1\|not specified	-11856	Benign
9:27562352	NM_018325.5(C9orf72):c.600+27A>G	NA	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-11132	Benign
9:27562406	NM_018325.5(C9orf72):c.573A>G (p.Lys191=)	rs775042273	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-11078	Uncertain significance
9:27562451	NM_018325.5(C9orf72):c.528T>C (p.Leu176=)	rs34608611	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-11033	Benign
9:27565556	NM_018325.5(C9orf72):c.477A>G (p.Leu159=)	rs374411112	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-7928	Likely benign
9:27565571	NM_018325.5(C9orf72):c.462C>T (p.Val154=)	rs188263738	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-7913	Benign
9:27566790	NM_018325.5(C9orf72):c.329A>G (p.Tyr110Cys)	rs1375695528	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-6694	Uncertain significance
9:27566831	NM_018325.5(C9orf72):c.288A>G (p.Ser96=)	rs147752518	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1\|not provided	-6653	Benign
9:27566901	NM_018325.5(C9orf72):c.218G>A (p.Arg73Gln)	rs1819480368	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-6583	Uncertain significance
9:27567126	NM_018325.5(C9orf72):c.-8A>G	rs548524458	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-6358	Uncertain significance
9:27567145	NM_018325.5(C9orf72):c.-27G>A	rs10757668	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	-6339	Benign
9:27573523	NG_031977.1:g.(5321_5338)ins(360_?)	rs143561967	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	39	Pathogenic
9:27573527	NM_001256054.1(C9orf72):c.-45+163GGGGCC[>24]	NA	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	43	Pathogenic
9:27573527	NM_001256054.2(C9orf72):c.-45+163_-45+180GGGGCC(2_25)	NA	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	43	Benign
9:27573527	NG_031977.1:g.(5321_5338)ins(360_?)	rs143561967	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	43	Pathogenic
9:27573527	NM_001256054.1(C9orf72):c.-45+163GGGGCC[>24]	NA	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	43	Pathogenic
9:27573527	NM_001256054.2(C9orf72):c.-45+163_-45+180GGGGCC(2_25)	NA	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	43	Benign
9:27573527	NG_031977.1:g.(5321_5338)ins(360_?)	rs143561967	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	43	Pathogenic
9:27573529	NM_001256054.1(C9orf72):c.-45+163GGGGCC[>24]	NA	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	45	Pathogenic
9:27573529	NM_001256054.2(C9orf72):c.-45+163_-45+180GGGGCC(2_25)	NA	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	45	Benign
9:27573709	NM_001256054.3(C9orf72):c.-47G>A	rs886063846	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	225	Uncertain significance
9:27573775	NM_001256054.3(C9orf72):c.-113C>G	rs750403732	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	291	Uncertain significance
9:27573775	NM_145005.7(C9orf72):c.-45+10C>T	NA	not provided	291	Uncertain significance
9:27573777	NM_001256054.3(C9orf72):c.-115A>C	rs183102304	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	293	Uncertain significance
9:27573814	NM_001256054.3(C9orf72):c.-152A>G	rs756998583	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	330	Uncertain significance
9:27573819	NM_001256054.3(C9orf72):c.-157G>A	rs1819655845	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	335	Uncertain significance
9:27573826	NM_001256054.3(C9orf72):c.-164T>C	rs41272893	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	342	Benign
9:27573830	NM_145005.7(C9orf72):c.-91dup	rs886063847	Amyotrophic Lateral Sclerosis/Frontotemporal Dementia	346	Uncertain significance
9:27573835	NM_001256054.3(C9orf72):c.-173A>G	rs886063848	Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	351	Uncertain significance

No Alu found near the repeat

Conservation score was not calculated

Position	Population	BlockLength (kb)	Distance	Location with respect to STR	No. of SNPs	SNPs in the Haploblock
9:27524278-27525529	AFR	1.252	-49206	downstream	12	rs56087834, rs112562467, rs58668566, rs144060127, rs34933275, rs700785, rs35122540, rs41272879, rs73643405, rs3849939, rs700783, rs7968697,
9:27524278-27524327	all_pop	0.05	-49206	downstream	2	rs56087834, rs5866856,
9:27525221-27535342	all_pop	10.122	-48263	downstream	29	rs3849939, rs700783, rs62538061, rs140290319, rs10967973, rs700782, rs3739528, rs3739527, rs2453553, rs2484316, rs11410615, rs4879540, rs2453552, rs10757664, rs58933219, rs5897238, rs903603, rs3202600, rs3736321, rs3202601, rs3736319, rs73440920, rs10812609, rs36046457, rs13290599, rs4879541, rs10812610, rs34606070, rs276432,
9:27525221-27529863	AMR	4.643	-48263	downstream	18	rs3849939, rs62538061, rs10967973, rs41272883, rs700782, rs2484316, rs11410615, rs4879540, rs2453552, rs10757664, rs58933219, rs5897238, rs903603, rs77812016, rs3202600, rs3736321, rs3202601, rs373631,
9:27525221-27534412	EAS	9.192	-48263	downstream	25	rs3849939, rs62538061, rs140290319, rs10967973, rs700782, rs3739528, rs3739527, rs2484316, rs11410615, rs4879540, rs2453552, rs10757664, rs58933219, rs5897238, rs903603, rs3202600, rs3736321, rs3202601, rs3736319, rs10812609, rs36046457, rs13290599, rs4879541, rs10812610, rs3460607,
9:27525221-27530467	EUR	5.247	-48263	downstream	22	rs3849939, rs62538061, rs140290319, rs10967973, rs41272883, rs700782, rs3739528, rs3739527, rs2484316, rs11410615, rs4879540, rs2453552, rs10757664, rs58933219, rs5897238, rs903603, rs77812016, rs3202600, rs3736321, rs3202601, rs3736319, rs1081260,
9:27525221-27529820	SAS	4.6	-48263	downstream	20	rs3849939, rs62538061, rs140290319, rs10967973, rs41272883, rs700782, rs3739528, rs3739527, rs2484316, rs11410615, rs4879540, rs2453552, rs10757664, rs58933219, rs5897238, rs903603, rs77812016, rs3202600, rs3736321, rs320260,
9:27526047-27541832	AFR	15.786	-47437	downstream	65	rs700782, rs41272885, rs73643406, rs2453553, rs2484316, rs75633587, rs11410615, rs4879540, rs2453552, rs10757664, rs2453551, rs183100834, rs58933219, rs5897238, rs903603, rs3202600, rs3736321, rs114477006, rs3202601, rs3736319, rs73643407, rs73440920, rs10812609, rs2256348, rs12340369, rs78963169, rs12115245, rs17769187, rs17769199, rs4879541, rs77369719, rs12115423, rs10812610, rs77896418, rs3893203, rs2764326, rs3849940, rs73643408, rs2814707, rs36038669, rs76252824, rs2477523, rs73643409, rs17696517, rs7029999, rs56097372, rs7030008, rs35767997, rs17769205, rs60368993, rs12337979, rs78741458, rs73643410, rs73643411, rs73643412, rs73440924, rs3849941, rs73643414, rs36021887, rs73643415, rs56168642, rs7469146, rs34752075, rs7038840, rs7272750,
9:27529863-27544943	SAS	15.081	-43621	downstream	35	rs3736319, rs10812609, rs36046457, rs13290599, rs4879541, rs10812610, rs34606070, rs2764326, rs71510498, rs2814707, rs36038669, rs2477523, rs7030008, rs78741458, rs35150443, rs3849941, rs74823641, rs36021887, rs35813780, rs149239630, rs7469146, rs34752075, rs10967975, rs72727506, rs67483205, rs72727507, rs10812611, rs17835843, rs3861016, rs35159554, rs3849942, rs3849943, rs17769217, rs6476001, rs1096797,
9:27530467-27543382	AMR	12.916	-43017	downstream	25	rs10812609, rs4879541, rs10812610, rs2764326, rs71510498, rs2814707, rs36038669, rs2477523, rs7030008, rs78741458, rs3849941, rs74823641, rs36021887, rs149239630, rs7469146, rs34752075, rs10967975, rs72727506, rs67483205, rs72727507, rs10812611, rs3861016, rs35159554, rs3849942, rs384994,
9:27532512-27543936	EUR	11.425	-40972	downstream	31	rs36046457, rs13290599, rs4879541, rs10812610, rs34606070, rs2764326, rs71510498, rs2814707, rs36038669, rs2477523, rs7030008, rs78741458, rs35150443, rs3849941, rs36021887, rs35813780, rs149239630, rs7469146, rs34752075, rs10967975, rs72727506, rs67483205, rs72727507, rs10812611, rs17835843, rs3861016, rs35159554, rs3849942, rs3849943, rs17769217, rs647600,
9:27535342-27537963	EAS	2.622	-38142	downstream	7	rs2764326, rs71510498, rs2814707, rs36038669, rs2477523, rs7030008, rs7874145,
9:27536311-27537271	all_pop	0.961	-37173	downstream	6	rs71510498, rs2814707, rs36038669, rs2477523, rs7029999, rs703000,
9:27537800-27537963	all_pop	0.164	-35684	downstream	2	rs12337979, rs7874145,
9:27538563-27541341	all_pop	2.779	-34921	downstream	7	rs35150443, rs3849941, rs74823641, rs36021887, rs35813780, rs7469146, rs3475207,
9:27538948-27540048	EAS	1.101	-34536	downstream	3	rs3849941, rs74823641, rs3602188,
9:27540414-27555121	EAS	14.708	-33070	downstream	44	rs35813780, rs7469146, rs34752075, rs10967975, rs72727506, rs67483205, rs10812611, rs17835843, rs3861016, rs35159554, rs3849942, rs3849943, rs6476001, rs10967976, rs10967977, rs812858, rs10812612, rs700791, rs4879554, rs5897242, rs9103, rs13691, rs3739526, rs572661170, rs2305045, rs10967979, rs773723, rs35362390, rs62538125, rs2453565, rs34592154, rs78922993, rs117867610, rs12347201, rs10967981, rs34620383, rs71510499, rs4878487, rs68005046, rs80272464, rs12349820, rs10124158, rs12686452, rs3581558,
9:27541450-27545960	all_pop	4.511	-32034	downstream	15	rs10967975, rs72727506, rs67483205, rs10812611, rs17835843, rs3861016, rs35159554, rs3849942, rs3849943, rs6476001, rs10967976, rs10967977, rs812858, rs10812612, rs70079,
9:27542261-27545545	AFR	3.285	-31223	downstream	15	rs10812611, rs7029638, rs35159554, rs60679461, rs3849942, rs3849943, rs7861220, rs12343756, rs59797827, rs774363, rs12339924, rs76403114, rs10967976, rs812858, rs1081261,
9:27544943-27545078	AMR	0.136	-28541	downstream	2	rs10967976, rs1096797,
9:27544943-27545078	EUR	0.136	-28541	downstream	2	rs10967976, rs1096797,
9:27545078-27547313	SAS	2.236	-28406	downstream	9	rs10967977, rs812858, rs10812612, rs700791, rs4879554, rs5897242, rs9103, rs13691, rs373952,
9:27545467-27547313	AMR	1.847	-28017	downstream	8	rs812858, rs10812612, rs700791, rs4879554, rs5897242, rs9103, rs13691, rs373952,
9:27545467-27547313	EUR	1.847	-28017	downstream	8	rs812858, rs10812612, rs700791, rs4879554, rs5897242, rs9103, rs13691, rs373952,
9:27546275-27547986	AFR	1.712	-27209	downstream	6	rs4879554, rs5897242, rs9103, rs13691, rs3739526, rs7344093,
9:27546275-27547313	all_pop	1.039	-27209	downstream	5	rs4879554, rs5897242, rs9103, rs13691, rs373952,
9:27548433-27548841	AMR	0.409	-25051	downstream	3	rs572661170, rs2305045, rs7272751,
9:27548433-27548927	EUR	0.495	-25051	downstream	3	rs572661170, rs72727512, rs1096797,
9:27548512-27548935	all_pop	0.424	-24972	downstream	4	rs2305045, rs72727512, rs10967979, rs77372,
9:27548927-27549755	AFR	0.829	-24557	downstream	4	rs10967979, rs773723, rs143033735, rs2852220,
9:27548927-27555016	AMR	6.09	-24557	downstream	16	rs10967979, rs773723, rs35362390, rs143236448, rs62538125, rs2453565, rs34592154, rs117867610, rs12347201, rs10967981, rs34620383, rs4878487, rs80272464, rs12349820, rs10124158, rs1268645,
9:27548927-27548935	SAS	0.009	-24557	downstream	2	rs10967979, rs77372,
9:27550073-27552193	AFR	2.121	-23411	downstream	11	rs2120720, rs10120734, rs10120735, rs10117558, rs62538125, rs2453565, rs34592154, rs145277983, rs12347201, rs73440934, rs1096798,
9:27550073-27555121	all_pop	5.049	-23411	downstream	17	rs2120720, rs62538125, rs2453565, rs34592154, rs117867610, rs12347201, rs10967981, rs34620383, rs71510499, rs4878487, rs68005046, rs2814705, rs80272464, rs12349820, rs10124158, rs12686452, rs3581558,
9:27550999-27551927	EUR	0.929	-22485	downstream	4	rs62538125, rs2453565, rs34592154, rs1234720,
9:27550999-27555121	SAS	4.123	-22485	downstream	15	rs62538125, rs2453565, rs34592154, rs117867610, rs12347201, rs10967981, rs34620383, rs71510499, rs4878487, rs68005046, rs80272464, rs12349820, rs10124158, rs12686452, rs3581558,
9:27552357-27558238	EUR	5.882	-21127	downstream	23	rs34620383, rs4878487, rs68005046, rs80272464, rs12349820, rs10124158, rs12686452, rs35815580, rs35184194, rs10967983, rs10967984, rs10122902, rs34670748, rs17835861, rs10812613, rs700828, rs4879564, rs10757665, rs67245195, rs4879565, rs4879566, rs369338530, rs1081261,
9:27553189-27555016	AFR	1.828	-20295	downstream	5	rs2814705, rs80272464, rs12349820, rs10124158, rs1268645,
9:27555556-27555817	all_pop	0.262	-17928	downstream	2	rs35184194, rs1096798,
9:27555556-27555817	SAS	0.262	-17928	downstream	2	rs35184194, rs1096798,